Induction and Evasion of Innate Antiviral Responses by Hepatitis C Virus

Abstract

Persistent hepatitis C virus infection is associated with progressive hepatic fibrosis and liver cancer. Acute infection evokes several distinct innate immune responses, but these are partially or completely countered by the virus. Hepatitis C virus proteins serve dual functions in replication and immune evasion, acting to disrupt cellular signaling pathways leading to interferon synthesis, subvert Jak-STAT signaling to limit expression of interferon-stimulated genes, and block antiviral activities of interferon-stimulated genes. The net effect is a multilayered evasion of innate immunity, which negatively influences the subsequent development of antigen-specific adaptive immunity, thereby contributing to virus persistence and resistance to therapy.

Acute hepatitis A virus infection is associated with a limited type I interferon response and persistence of intrahepatic viral RNA

“…28). This activates signaling pathways that lead to the phosphorylation of IFN-regulatory factor 3 (IRF-3) and type I IFN synthesis.…”

Complexity and Catalytic Efficiency of Hepatitis C Virus (HCV) NS3 and NS4A Protease Quasispecies Influence Responsiveness to Treatment with Pegylated Interferon plus Ribavirin in HCV/HIV-Coinfected Patients

“…The resulting PCR products were digested with NsiI and HindIII and ligated to pcI.HCVNS4B/NS5Acro previously digested with NsiI and HindIII. Escherichia coli JM109 cells containing plasmid pcI.Cardifcro were then transformed with plasmid pHCVNS3 2-181 /4 [21][22][23][24][25][26][27][28][29][30][31][32][33][34] protease. Transformed cells were grown overnight at 30°C in the presence of 0.2% maltose-12.5 g/ml of tetracycline-20 g/ml of ampicillin, harvested by centrifugation, and resuspended to an optical density at 600 nm of 2.0/ml in 10 mM MgSO 4 .…”

“…For subtype 1b, oligonucleotides HCVproL2 (sense, 5Ј-GGGTTGAATTCTAT GGCTCCTATTGGATCTGTTGTTATTGTTGGAAGAATTATTTTGTCTG GAAGAGGAGGACCTATCACGGCCTACTCCCAA-3Ј, residues 3414 to 3434 of the HCV-J strain) and HCVproR (antisense, 5Ј-GGGAGGGGCTCG AGTCAAGACCGCATAGTAGTTTCCAT-3Ј, residues 3933 to 3952 of the HCV-J strain) were used. The PCR products were digested with EcoRI and XhoI and ligated to pBSK (Stratagene) to generate a ␤-gal-HCV NS3 2-181 /4 [21][22][23][24][25][26][27][28][29][30][31][32][33][34] protease fusion protein (pHCVNS3 2-181 /4 21-34 protease). To ensure that multiple NS3/4 protease templates were present in each quasispecies that was analyzed, four different PCR amplifications were performed for each sample and pooled before cloning.…”

“…HCV NS3/4A protease functions as an antagonist of virus-induced interferon (IFN) regulatory factor 3 activation and IFN-␤ expression through its ability to block retinoic acid-inducible gen I (RIG-I) and Toll-like receptor 3 signaling by cleaving caspase recruitment domain adaptor-inducing IFN-␤ (Cardif) and Toll/interleukin-1 (IL-1) receptor domain-containing adaptor-inducing IFN proteins, respectively. NS3/4A protease activity allows the virus to evade the cellular innate immune response, which may influence the subsequent development of adaptive immunity to HCV, virus persistence, and the response to IFNbased therapy (21).…”

Tropism of human pegivirus (formerly known as GB virus C/hepatitis G virus) and host immunomodulation: insights into a highly successful viral infection

“…Many acute viral infections induce sterilizing T-and B-cell immune responses that clear the infection and result in immunological memory leaving the host resistant to Cox, 2010;Lemon, 2010). In contrast, HPgV envelope proteins do not have any hypervariable regions; the virus displays limited sequence variability within persistently infected hosts in protein regions predicted to be T-cell epitopes, and is associated with reduced T-cell activation and exhaustion (Mohr & Stapleton, 2009;Stapleton et al, 2012b …”