Induction of telomere shortening and cellular apoptosis by sodium meta-arsenite in human cancer cell lines

Abstract

The present study assessed the cytotoxicity of sodium meta-arsenite (SMA) on telomere shortening and cellular apoptosis in human A-549, MDA-MB-231 and U87-MG cancer cell lines. Following 2 weeks of 1 μM SMA treatment, population doubling time (PDT) was significantly (P < .05) increased by the inhibition of cell proliferation in all the cancer cell lines compared to that in untreated controls. Level of telomerase activity by relative-quantitative telomerase repeat amplification protocol was significantly (P < .05) downregulated by SMA treatment with significant (P < .05) decrease of both telomerase reverse transcriptase and telomerase RNA component transcripts, responsible for telomerase activity. A significant (P < .05) shortening of telomeric repeats by telomere restriction fragment analysis was consequently observed in SMA-treated cells. Moreover, high incidence of cells with senescence-associated β-glucosidase activity was observed in SMA-treated cells and some cells were also differentiated into adipocytes probably due to the loss of tumorous characterizations. Cellular apoptosis proven by DNA fragmentation was observed, and intrinsic apoptotic transcripts (BAX, caspase 3 and caspase 9) and stress-related transcripts (p21, HSP70 and HSP90) were significantly (P < .05) increased in three cancer cell lines treated with SMA. Based on the present study, SMA treatment apparently induced a shortening of telomere length and cytotoxicity, such as induction of cell senescence, apoptosis and cell differentiation. Therefore, we conclude that SMA treatment at specific concentration can lead to gradual loss of tumorous characterizations and can be considered as a potential anti-cancer drug for chemotherapy treatment.

Inhibition of cell growth by cellular differentiation into adipocyte-like cells in dexamethasone sensitive cancer cell lines

“…However, our results have demonstrated that growth inhibition is associated with the cellular differentiation into adipocyte-like cells rather than apoptosis in A-549 lung and MCF-7 cancer cells after being exposed to DEX at a concentration of 1 μg/ml. The high expression of SA β-gal activity is considered to be a marker of cellular aging and senescence preceding cellular apoptosis (Moon et al 2015 ; Kim et al 2017 ). In the present study, the activity of SA β-gal was not elevated in cancer cells treated with DEX, implying that the cellular senescence or apoptosis might not be induced by DEX exposure.…”

“…The expression level of the transcripts in each sample was calculated in relative to the expression level of a reference gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The sequences of primer used in this study were GAPDH and telomerase reverse transcriptase (TERT) related to telomerase activity were previously described (Kim et al, 2017 ). The primers for adipogenesis were glucose transporter 4 (GLUT4, sense: ATGCTGCTGCCTCCTATGAA, antisense: CAGTTGGTTGAGCGTCCC), glucocorticoid receptor β (GRβ, sense: GAAGGAAACTCCAGCCAGAAC, antisense: TGAGCGCCAAGATTGTTGG) and peroxisome proliferator-activated receptor γ (PPARγ, sense: CCTATTGACCCAGAAAGCGATT, antisense: CATTACGGAGAGATCCACGGA), and the size of PCR products was 146, 140 and 135 bp, respectively.…”

“…After being centrifuged for 20 min at 12,000 × g at 4°C, 60–70% (by volume) of the supernatant to remove cell debris and DNA was carefully collected to a fresh sample tube and the concentration of total protein in each sample was subsequently measured with a spectrophotometer (Mecasys, Korea). The reaction mixture for RQ-TRAP amplification was prepared with 1 μg total protein of each of the lysed sample, Rotor-Gene TM 2 × SYBR green kit (Qiagen, USA), 0.02 µg of telomerase TS primer and 0.04 µg of anchored return ACX primer in the 20 μl of final volume, and TS and ACX primer were previously described (Kim et al 2017 ). Before RQ-TRAP amplification, the reactions were incubated at 30°C for 30 min and subsequently at 94°C for 10 min for denaturation.…”

“…Cancer cells exhibit unlimited cell proliferation capacity by maintaining telomeric repeats at the DNA ends of linear chromosomes of eukaryotes, and these telomeric repeats are stabilized by highly up-regulated telomerase activity without shortening of these telomeric repeats compared to normal or fully differentiated cell lines having down-regulated telomerase activity at a basal level (Cong et al 2002 ; Arnoult and Karlseder 2015 ). The high level of telomerase activity is also one of the main criteria to define tumorous cells, and anti-tumor drugs for reducing telomerase activity and telomeric repeats have been continually developed and tried for cancer treatment (Hanahan and Weinberg 2000 ; Jeon et al 2011a ; Arnoult and Karlseder 2015 ; Kim et al 2017 ). However, the cytotoxic effect on telomerase activity is not fully investigated in both cancer and normal cells which are directly treated with GCs of high level until now.…”

Activation of integrated stress response pathway regulates IL‐1β production through posttranscriptional and translational reprogramming in macrophages

“…Arsenite exposure has been shown to activate ISR signaling through eIF2α phosphorylation and SGs formation . In addition, it has been demonstrated that arsenite influences various cellular processes like apoptosis, proliferation, inflammation, angiogenesis, and immune response . Therapeutically, arsenic compounds have often been used in traditional Chinese and Western medicine for decades to treat several diseases including tooth diseases, rheumatosis, psoriasis, syphilis, and trypanosomiasis .…”