Influence of Microbiota on Diabetic Foot Wound in Comparison with Adjacent Normal Skin Based on the Clinical Features

Abstract

Diabetic foot ulcer (DFU) is a complication experienced by diabetic patients and does not heal well in an altered wound environment. Although diverse microbes in DFU were detected, little is known about their influences on diabetic foot wound (DFW) and the association with the skin microbiota in normal tissue from the same patients according to clinical features. We aimed to analyze the microbiota in normal skin and DFW tissue from the same subject and predict their roles based on clinical features. We analyzed the microbiota in normal skin and DFW tissue from the same subject and compared the associated members of microbiota with clinical parameters. The diversity of skin microbiota was higher than that of DFW tissues, along with compositional differences. In addition, different microbes were associated with clinical features. The proportions of Bacteroidetes, Prevotella, Peptoniphilus, Porphyromonas, and Dialister were higher in the severe groups than of the mild groups, whereas that of Firmicutes was lower in the severe groups. According to wound severity, the microbiota could be related to inflammation, damaging host cell membrane, and pathogenicity through lipopolysaccharide biosynthesis, cellular antigens, and protein digestion metabolism. The predicted DFW microbiota functions according to systemic diabetic status defined by ESRD and HbA1c, differed from those presented by wound severity. Results indicate that the microbiota in normal skin is related to the colonizing microbes in DFW tissue according to clinical features and the different microbes can play important roles in DFW prognosis. This information can be applied to prevent and manage DFW by modulating the microbiota.

Breast-Milk Microbiota Linked to Celiac Disease Development in Children: A Pilot Study From the PreventCD Cohort

“…As a result and, in addition to those species described in Table 2, we found that the abundance of P. timonensis and Actinomyces turicensis related OTUs were increased in milk samples from mothers whose children developed CeD. In this regard, Peptoniphilus species have been considered as potential inducers of pro-inflammatory signals associated with an increased risk of suffering from human immunodeficiency virus (HIV) infection and wound severity in skin ulcers (Liu et al, 2017;Park et al, 2019), which could also confer higher susceptibility to other inflammatory conditions such as CeD. Moreover, breast abscesses caused by A. turicensis and Peptoniphilus harei also indicate these bacterial taxa are potentially pathogenic (Le Bihan et al, 2019).…”

Alteration of Gut Microbiota in Carbapenem-Resistant Enterobacteriaceae Carriers during Fecal Microbiota Transplantation According to Decolonization Periods

“…To analyze the microbiota in samples, metagenomic DNA was amplified following the 16S Metagenomic Sequencing library for the MiSeq system manufacturer’s guidelines (Illumina, San Diego, CA, USA), as described previously [ 21 , 22 ]. Briefly, the V1–V3 hypervariable regions of the 16S rRNA gene were amplified using primers with adapters (forward: 5′-adapter [TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG]- GAGTTTGATCMTGGCTCAG-3′; reverse: 5′-adapter [GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG]-ATTACCGCGGCTGCTGG-3′).…”

Factors related to the composition and diversity of wound microbiota investigated using culture-independent molecular methods: a scoping review

“…In the 10 studies investigating patient characteristics, diabetes mellitus was investigated as a factor related to microbial diversity in wounds in seven studies. Indicators used included a diagnosis of diabetes mellitus (18,19), hemoglobin A1c (HbA1c) levels (11,(20)(21)(22)(23), and the duration of diabetes mellitus (20). Among them, both HbA1c levels and the duration of a patient's diabetes mellitus correlated with the alpha diversity index (dominance, p = 0.0174; diversity, p = 0.0168, the correlation coefficient was not shown) (20).…”