Influenza Viruses in Mice: Deep Sequencing Analysis of Serial Passage and Effects of Sialic Acid Structural Variation

Abstract

Influenza A viruses have regularly jumped to new hosts to cause epidemics or pandemics, an evolutionary process that involves variation in the viral traits necessary to overcome host barriers and facilitate transmission. Mice are not a natural host for influenza virus, but are frequently used as models in studies of pathogenesis, often after multiple passages to achieve 30 higher viral titers that result in clinical disease such as weight loss or death. Here we examine the processes of influenza A virus infection and evolution in mice by comparing deep sequence variation of a human H1N1 pandemic virus, a seasonal H3N2 virus, and a H3N2 canine influenza virus during experimental passage. We also compared replication and sequence variation in wild-type mice expressing N-glycolylneuraminic acid (Neu5Gc) with that seen in 35 mice expressing only N-acetylneuraminic acid (Neu5Ac). Viruses derived from plasmids were propagated in MDCK cells and then passaged in mice up to four times. Full genome deep sequencing of the plasmids, cultured viruses, and viruses from mice at various passages revealed only small numbers of mutational changes. The H3N2 canine influenza virus showed increases in frequency of sporadic mutations in the PB2, PA, and NA segments. The H1N1 40 pandemic virus grew well in mice, and while it exhibited the maintenance of some minority mutations, there was no clear adaptive evolution. The H3N2 seasonal virus did not establish in the mice. Finally, there were no clear sequence differences associated with the presence or absence of Neu5Gc. 45 SIGNIFICANCEMice are commonly used as a model to study the growth and virulence of influenza A viruses in mammals, but are not a natural host and have distinct sialic acid receptor profiles compared to humans. Using experimental infections with different subtypes of influenza A virus derived from different hosts we found that evolution of influenza A virus in mice did not necessarily proceed 50 through the linear accumulation of host-adaptive mutations, that there was variation in the

Sequence dynamics of three influenza A virus strains grown in different MDCK cell lines, including those expressing different sialic acid receptors

“…While replication in cell culture lacks many of the selective pressures found in natural infection, low levels of diversity within the IAV sequences in natural samples have been reported in human, equine and canine infections (Debbink et al., 2017; Valesano et al., 2019; Hoelzer et al, 2010; Murcia et al, 2010). Similar results were seen with the same strains of IAV used in this study when passaged in wild‐type or CMAH ‐/‐ mice (Wasik et al., 2019). Some minority variants arose in individual virus population genomes in our different replicate experiments, in which three virus populations were passaged 5 times in MDCK‐WT or MDCK‐CMAH cells, revealing little variation within populations, but some variation between populations.…”

“…vRNA was extracted from the stock virus, and from virus populations recovered after passage 1, 5 and 10 and sequenced using Illumina MiSeq. Library generation was performed as previously described (Wasik et al., 2019). In brief, total vRNA was incubated with Superscript III and Platinum Taq‐HiFi (Invitrogen) in the presence of universal influenza amplifying primers (5′ to 3′, uni12a: GTTACGCGCCAGCAAAAGCAGG; uni12b: GTTACGCGCCAGCGAAAGCAGG; uni13: GTTACGCGCCAGTAGAAACAAGG).…”

Swine H1N1 influenza virus variants with enhanced polymerase activity and HA stability promote airborne transmission in ferrets

“…Deep sequencing of samples from H7N9-infected patients and their surrounding poultry/environment showed acquisition of the polymerase-enhancing PB2-E627K variation in humans (45). H3N2 and H1N1 growth in mice has been shown to not necessarily proceed through linear accumulation of adaptative mutations (65). Overall, as next-generation sequencing becomes cheaper, faster, and more efficient, real-time monitoring of human-adaptive variations may enable better preparedness for future outbreaks.…”

Insights from the comparison of genomic variants from two influenza B viruses grown in the presence of human antibodies in cell culture

“…Parallel evolution in the HA gene has previously been observed after passage of influenza A virus in mouse lungs [ 53 ]. More in depth analyses of influenza A viruses passaged in mice demonstrated that single nucleotide variants associated with adaptation were present in all genomic segments [ 22 , 54 ]. Our prior analysis of the HA gene demonstrated parallel evolution in IBV [ 41 ].…”

“…A small study by Rutvisuttinunt et al, revealed that clinical influenza isolates had more nucleotide diversity than the cultured isolates [ 21 ]. Wasik et al, demonstrated that viruses derived from plasmids also presented as a quasispecies with low levels of variants that didn’t become fixed [ 22 ]. Both antigenic and non-antigenic changes that become fixed can affect viral fitness [ 23 ].…”