Inhibition of MARCH5 ubiquitin ligase abrogates MCL1-dependent resistance to BH3 mimetics <i>via</i> NOXA

Subramanian, Aishwarya; Andronache, Adrian; Li, Yao-Cheng; Wade, Mark

doi:10.18632/oncotarget.7558

Cited by 38 publications

(49 citation statements)

References 53 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The E3 ubiquitin ligase MARCH5 showed strong synthetic lethality with BCL2L1 in both Meljuso (rank 1, Z-score -11.3) and OVCAR8 (rank 1, Z-score -6.1). Previous studies have shown that MCL1 levels are elevated in MARCH5 knockout cells 31 , and siRNA-mediated knockdown of MARCH5 led to loss of MCL1-mediated resistance to the BCL2-family inhibitor ABT-737 32 . Two additional top synthetic lethal hits with BCL2L1 are the E2 ligases UBE2J2 (rank 3, Z-score -7.2 across all conditions) and UBE2K (rank 5, Z-score -5.1).…”

Section: Anchor Screens For the Anti-apoptotic Genes Bcl2l1 And Mcl1mentioning

confidence: 91%

Genetic screens in isogenic mammalian cell lines without single cell cloning

DeWeirdt

Sanson

Hanna

et al. 2019

Preprint

View full text Add to dashboard Cite

Isogenic pairs of cell lines, which differ by a single genetic modification, are powerful tools for understanding gene function. Generating such pairs for mammalian cells, however, is labor-intensive, time-consuming, and impossible in some cell types. Here we present an approach to create isogenic pairs of cells and screen them with genome-wide CRISPR-Cas9 libraries to generate genetic interaction maps. We queried the anti-apoptotic genes BCL2L1 and MCL1, and the DNA damage repair gene PARP1, via 25 genome-wide screens across 4 cell lines. For all three genes, we identify a rich set of both expected and novel buffering and synthetic lethal interactions. Further, we compare the interactions observed in genetic space to those found when targeting these genes with small molecules and identify hits that may inform the clinical uses for these inhibitors. We anticipate that this methodology will be broadly useful to comprehensively study genes of interest across many cell types.Genetic interaction networks can suggest functional roles of uncharacterized genes and capture subtle biological interactions, which may prove critical for interpreting genetic signal from genome-wide association studies of common disease states. Crosses of yeast knockout strains have yielded rich networks of genetic interactions, and have further shown that the shape of the network will change based on growth conditions 1-5 . In mammalian cells, the construction of such networks is orders of magnitude more complicated, due to increased genome size, the diversity of cell types, and numerous technical factors. One approach is to use either RNAi 6 or CRISPR technology 7-11 to screen a library of all possible combinatorial perturbations within a focused gene list. This approach has been used to generate genetic interaction maps for up to hundreds of genes 12 ; however, screening all combinations of protein coding genes in the human genome would require, at bare minimum, approximately 400 million perturbations and 200 billion cells, which is equivalent to 5,000 concurrent genome-wide screens with typical guide libraries and currently exceeds the practical limits of tissue culture. This scale is exacerbated by the diversity of cell types in which to study such interactions.A second, complementary approach to query genetic interactions leverages isogenic pairs of human cells, akin to mutant strains of model organisms, to enable the delineation of a given gene's contribution to phenotypes of interest. Initial gene targeting approaches in human cell lines to create even a single knockout have yielded valuable insights but were quite laborious to generate [13][14][15][16][17][18][19] . Today, CRISPR technology has made cell line engineering possible for a broad range of researchers, but that is distinct from making it easy. Creating the site-specific nuclease for Cas9 is as simple as ordering a short nucleic acid, in contrast to the more expensive and time-consuming task of assembling a customized pair of zinc finger nucleases or TALENs 20 . After design...

show abstract

Section: Anchor Screens For the Anti-apoptotic Genes Bcl2l1 And Mcl1mentioning

confidence: 91%

Genetic screens in isogenic mammalian cell lines without single cell cloning

DeWeirdt

Sanson

Hanna

et al. 2019

Preprint

View full text Add to dashboard Cite

show abstract

“…HCT116 cells (ATCC® CCL-247) were grown in McCoy's 5A-Medium (Szabo Scandic, Vienna, Austria, BE12-688F) supplemented with 10% FCS, 100 U/ml Penicillin, and 100 µg/ml Streptomycin. U2OS Flag-March5 cells were a gift from Mark Wade [22]. HCT116-allBCL2KO cells were described in [28].…”

Section: Cell Culturementioning

confidence: 99%

“…The siMARCH5 #1 sequence was used where the number is not specified. All siRNAs were ordered from Microsynth, Balgach, Switzerland: GL2 (targeting luciferase) CGUACGCGGAA UACUUCGAdTdT [29], siNOXA GGUGCACGUUUCA UCAAUUdTdT [30], siMCL1 GGACUUUUAUACCUGU UAUdTdT [31], siBIM GGAGACGAGUUUAACGCUUA dTdT [32], siMARCH5 #1 GGACAGCUGUGACUUAUG GdTdT [22], siMARCH5 #2 GUAAAUUGAUGUUCAGU AGdTdT [22].…”

Section: Cell Synchronization and Drug Treatmentsmentioning

confidence: 99%

“…The controversy still exists as to which E3-ligases control MCL1 levels in response to different types of stress including mitotic arrest [8,20]. One E3-ligase that has been shown to regulate BCL2 family proteins is membrane associated RING finger protein 5 (MARCH5) [21,22]. In contrast to all other E3-ligases discussed, MARCH5 is a transmembrane protein located at the outer mitochondrial membrane with a cytoplasmatic RING finger domain.…”

Section: Introductionmentioning

confidence: 99%

“…Its best documented role lies in the regulation of mitochondrial fission dynamics [21,23] but it appears to be involved in other processes like mitochondrial quality control [24], mitophagy [25], and antiviral signaling [26]. Furthermore, cells lacking MARCH5 show increased rates of cell death upon drug treatment [22,23,27].…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

MARCH5-dependent degradation of MCL1/NOXA complexes defines susceptibility to antimitotic drug treatment

et al. 2020

View full text Add to dashboard Cite

Cells experiencing delays in mitotic progression are prone to undergo apoptosis unless they can exit mitosis before proapoptotic factors reach a critical threshold. Microtubule targeting agents (MTAs) arrest cells in mitosis and induce apoptotic cell death engaging the BCL2 network. Degradation of the antiapoptotic BCL2 family member MCL-1 is considered to set the time until onset of apoptosis upon MTA treatment. MCL1 degradation involves its interaction with one of its key binding partners, the proapoptotic BH3-only protein NOXA. Here, we report that the mitochondria-associated E3ligase MARCH5, best known for its role in mitochondrial quality control and regulation of components of the mitochondrial fission machinery, controls the levels of MCL1/NOXA protein complexes in steady state as well as during mitotic arrest. Inhibition of MARCH5 function sensitizes cancer cells to the proapoptotic effects of MTAs by the accumulation of NOXA and primes cancer cells that may undergo slippage to escape death in mitosis to cell death in the next G1 phase. We propose that inhibition of MARCH5 may be a suitable strategy to sensitize cancer cells to antimitotic drug treatment.

show abstract

Overcoming chemotherapy drug resistance by targeting inhibitors of apoptosis proteins (IAPs)

et al. 2017

View full text Add to dashboard Cite

Inhibitors of apoptosis (IAPs) are a family of proteins that play a significant role in the control of programmed cell death (PCD). PCD is essential to maintain healthy cell turnover within tissue but also to fight disease or infection. Uninhibited, IAPs can suppress apoptosis and promote cell cycle progression. Therefore, it is unsurprising that cancer cells demonstrate significantly elevated expression levels of IAPs, resulting in improved cell survival, enhanced tumor growth and subsequent metastasis. Therapies to target IAPs in cancer has garnered substantial scientific interest and as resistance to anti-cancer agents becomes more prevalent, targeting IAPs has become an increasingly attractive strategy to re-sensitize cancer cells to chemotherapies, antibody based-therapies and TRAIL therapy. Antagonism strategies to modulate the actions of XIAP, cIAP1/2 and survivin are the central focus of current research and this review highlights advances within this field with particular emphasis upon the development and specificity of second mitochondria-derived activator of caspase (SMAC) mimetics (synthetic analogs of endogenously expressed inhibitors of IAPs SMAC/DIABLO). While we highlight the potential of SMAC mimetics as effective single agent or combinatory therapies to treat cancer we also discuss the likely clinical implications of resistance to SMAC mimetic therapy, occasionally observed in cancer cell lines.

show abstract

Inhibition of MARCH5 ubiquitin ligase abrogates MCL1-dependent resistance to BH3 mimetics via NOXA

Cited by 38 publications

References 53 publications

Genetic screens in isogenic mammalian cell lines without single cell cloning

Genetic screens in isogenic mammalian cell lines without single cell cloning

MARCH5-dependent degradation of MCL1/NOXA complexes defines susceptibility to antimitotic drug treatment

Overcoming chemotherapy drug resistance by targeting inhibitors of apoptosis proteins (IAPs)

Contact Info

Product

Resources

About