Inhibition of translation termination by Drosocin, an antimicrobial peptide from fruit flies

Abstract

A 19-amino acid long proline-rich antimicrobial peptide (PrAMP) Drosocin (Dro) is encoded in the fruit fly genome. Native Dro is glycosylated at a specific threonine residue, but the non-glycosylated peptide retains antibacterial activity. Dro shows sequence similarity to several other PrAMPs that bind in the ribosomal nascent peptide exit tunnel and inhibit protein synthesis by varying mechanisms. However, the target and mechanism of action of Dro remain unknown. Here we show that the primary mode of Dro action is inhibition of termination of protein synthesis. Our in vitro and in vivo experiments demonstrate that Dro stalls ribosomes at stop codons, likely sequestering class 1 release factors associated with the terminating ribosome. As the result, Dro, at subinhibitory concentrations, strongly promotes readthrough of stop codons. The elucidated mode of Dro action allows assigning it as the second member of the type II PrAMPs, of which only one representative, the antimicrobial peptide apidaecin (Api) produced by honeybees, was previously known. However, despite its functional similarity with Api, Dro interacts with the target in a markedly distinct way. The analysis of a comprehensive single-amino acid substitution library of endogenously expressed Dro variants shows that binding to the ribosome involves interactions of multiple amino acid residues distributed through the entire length of the PrAMP. Our data further show that the ribosome-targeting activity of non-glycosylated Dro can be significantly enhanced by single amino acid substitutions illuminating directions for improving its antibacterial properties.

Multimodal binding and inhibition of bacterial ribosomes by the antimicrobial peptides Api137 and Api88

“…To further explore the translation inhibition of Api88, the effects of Api88 on ribosome progression were tested by toeprinting, which allows mapping of the site of inhibitor-induced ribosome stalling during in vitro translation 22 . Consistent with previous reports 11,21 , Api137 arrested translation at the mRNA stop codon resulting in an intense toeprinting band at a concentration of 50 µmol/L (Fig. 1d).…”

“…This prompted us to investigate potential differences in the modes of action of Api137 and Api88. We first investigated their effect on protein translation in the presence or absence of the RFs using an in vitro transcriptiontranslation (ITT) assay 20,21 . The production of superfolder GFP (sfGFP) in the absence of RF1 was reduced by both Api88 and Api137 to a similar extent, down to ~60% at the highest peptide concentration tested, 50 µmol/L (Fig.…”

“…Toeprinting experiments using the yrbA-fs15 DNA template with a TAG stop codon were performed in the NEB classic PURExpress system (New England Biolabs) 21 as described above. The template was prepared by PCR 21 by combining the overlapping primers T7, T7-IR-AUG, IR-yrbA-fs15-RF1 (for TAG), post-NV1, and NV1, rendering the sequence: TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAACAT ATGATATACCCCTGCGGAGTGGGCGCGCGATCGCAAACTGAACGGC TT(TAG)GCCGACCTCGACAGTTGGATTCACGTGCTGAATCCTGATGC GATGTCGAGTTAATAAGCAAAATTCATTATAACC (ORF sequence is underlined). The peptides Api137 and Api88 were added from stock solutions in water to a final concentration of 50 µM.…”

When the microbiome shapes the host: immune evolution implications for infectious disease

“…This suggests their specificity is instead owing to differences in their binding affinity for the microbes they target. Drosocin has many functional analogues across insect immune systems [18,55,56]. The specific importance of Drosocin against Enterobacter cloacae [23,47], coupled with recent data showing that Drosocin binds to bacterial ribosomes to inhibit translation [55,57], suggests a characteristic of the Enterobacter cloacae ribosome could make it specifically susceptible to Drosocin attack.…”

“…Drosocin has many functional analogues across insect immune systems [18,55,56]. The specific importance of Drosocin against Enterobacter cloacae [23,47], coupled with recent data showing that Drosocin binds to bacterial ribosomes to inhibit translation [55,57], suggests a characteristic of the Enterobacter cloacae ribosome could make it specifically susceptible to Drosocin attack. Other mediators of Drosocin-bacteria specificity could include cell membrane components such as uptake permeases, which import Drosocin-like peptides into the cell [56,58], a prerequisite for ensuing ribosome attack.…”