Initiating a structural study of 2-keto-3-deoxy-6-phosphogluconate aldolase from <i>Escherichia coli</i>

Buchanan, Louise V.; Mehta, Nupur; Pocivavsek, Luka; Niranjanakumari, Somashekarappa; Toone, Eric J.; Naismith, James H.

doi:10.1107/s0907444999011166

Cited by 4 publications

(2 citation statements)

References 17 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The QuikChange (Stratagene) method with the following primers and their reverse complements was used to construct the vectors: T161S 5′ - CCAGGTCCGTTTCTGCCCGTCGGGTGGTATTTCTCCGGCTAAC - 3′; S184F 5′- GCTGTGCATCGGTGGTTTCTGGCTGGTTCCGGCAG - 3′; and S184L 5′- GCTGTGCATCGGTGGTCTCTGGCTGGTTCCGGCAG - 3′. The pET-ECEDA plasmid( 25 ) encodes the E. coli eda gene behind a T7 polymerase promoter and contains an N-terminal 6 × His-tag. After whole plasmid PCR amplification with PFU Turbo (Stratagene) and exhaustive digestion with DpnI (NEB), the products were transformed into SmartCells.…”

Section: Methodsmentioning

confidence: 99%

Improving upon Nature: Active Site Remodeling Produces Highly Efficient Aldolase Activity toward Hydrophobic Electrophilic Substrates

2012

Self Cite

View full text Add to dashboard Cite

Substrate specificity of enzymes is frequently narrow and constrained by multiple interactions, limiting the use of natural enzymes in biocatalytic applications. Aldolases have important synthetic applications, but the usefulness of these enzymes is hampered by their narrow reactivity profile with unnatural substrates. To explore the determinants of substrate selectivity and alter the specificity of E. coli 2-keto-3-deoxy-6-phosphogluconate (KDPG) aldolase, we employed structure-based mutagenesis coupled with library screening of mutant enzymes localized to the bacterial periplasm. We identified two active site mutations (T161S/S184L) that work additively to enhance the substrate specificity of this aldolase to include catalysis of retro-aldol cleavage of (4S)-2-keto-4-hydroxy-4-(2′-pyridyl)butyrate (S-KHPB). These mutations improve the value of kcat/KMS-KHPB by >450-fold, resulting in a catalytic efficiency that is comparable to that of the wild-type enzyme with the natural substrate while retaining high stereoselectivity. Moreover, the value of kcatS-KHPB for this mutant enzyme, a parameter critical for biocatalytic applications, is 3-fold higher than the maximum value achieved by the natural aldolase with any substrate. This mutant also possesses high catalytic efficiency for the retro-aldol cleavage of the natural substrate, KDPG, and a >50-fold improved activity for cleavage of 2-keto-4-hydroxy-octonoate (KHO), a non-functionalized hydrophobic analog. These data suggest a substrate binding mode that illuminates the origin of facial selectivity in aldol addition reactions catalyzed by KDPG and 2-keto-3-deoxy-6-phosphogalactonate (KDPGal) aldolases. Furthermore, targeting mutations to the active site provides marked improvement in substrate selectivity, demonstrating that structure-guided active site mutagenesis combined with selection techniques can efficiently identify proteins with characteristics that compare favorably to naturally occurring enzymes.

show abstract

Section: Methodsmentioning

confidence: 99%

Improving upon Nature: Active Site Remodeling Produces Highly Efficient Aldolase Activity toward Hydrophobic Electrophilic Substrates

2012

Self Cite

View full text Add to dashboard Cite

show abstract

“…To date, amongst the three most synthetically useful KDPG aldolases, crystallization and diffraction data collection were reported for the E. coli aldolase [19], although only the crystal structure of the Pseudomonas putida aldolase has been determined [20]. The P. putida enzyme belongs to the common TIM-barrel family and is believed to be trimeric in solution.…”

Section: Mutations Observed In the Evolved Aldolasesmentioning

confidence: 99%

Directed evolution of D-2-keto-3-deoxy-6-phosphogluconate aldolase to new variants for the efficient synthesis of D- and L-sugars

Fong

Machajewski

Mak

et al. 2000

Chemistry & Biology

152

View full text Add to dashboard Cite

This research has demonstrated the effectiveness of using in vitro evolution to rapidly alter the properties of an aldolase to improve its utility in asymmetric synthesis. The evolved aldolases, differing from the native enzyme which is highly phosphate- and D-sugar-dependent, catalyze the efficient synthesis of both D- and L-sugars from non-phosphorylated aldehydes and pyruvate. The principles and strategies described in this study should be applicable to other aldolases to further expand the scope of their synthetic utility.

show abstract

A bacterial selection for the directed evolution of pyruvate aldolases

Griffiths

Cheriyan

Corbell

et al. 2004

Bioorganic & Medicinal Chemistry

View full text Add to dashboard Cite

Initiating a structural study of 2-keto-3-deoxy-6-phosphogluconate aldolase from Escherichia coli

Cited by 4 publications

References 17 publications

Improving upon Nature: Active Site Remodeling Produces Highly Efficient Aldolase Activity toward Hydrophobic Electrophilic Substrates

Improving upon Nature: Active Site Remodeling Produces Highly Efficient Aldolase Activity toward Hydrophobic Electrophilic Substrates

Directed evolution of D-2-keto-3-deoxy-6-phosphogluconate aldolase to new variants for the efficient synthesis of D- and L-sugars

A bacterial selection for the directed evolution of pyruvate aldolases

Contact Info

Product

Resources

About