Insertional inactivation of a Tet(K)/Tet(L) like transporter does not eliminate tetracycline resistance in Bacillus cereus

Økstad, Ole Andreas; Grønstad, A; Lindbäck, Toril; Kolstø, Anne‐Brit

doi:10.1111/j.1574-6968.1997.tb12641.x

Cited by 3 publications

(1 citation statement)

References 19 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The suicide vector pAT113 (Kan r Ery r ) (34) and its derivative, pFX113 (Kan r Spc r ) (3), can be introduced from E. coli by conjugation and have been used successfully for gene knockout by allelic exchange in both B. cereus (20) and B. anthracis (27). Primers EyF1 (CCCATACACCTGTACACCAATAACAGC) and EyR1 (GTCCCACA TAATAAATCATTTAAGGATATG) were used with Expand HiFi polymerase (Roche) to generate a 1.1-kb PCR product that contained the B. cereus exsY gene and flanking DNA.…”

Section: Methodsmentioning

confidence: 99%

ExsY and CotY Are Required for the Correct Assembly of the Exosporium and Spore Coat of Bacillus cereus

et al. 2006

View full text Add to dashboard Cite

The exosporium-defective phenotype of a transposon insertion mutant of Bacillus cereus implicated ExsY, a homologue of B. subtilis cysteine-rich spore coat proteins CotY and CotZ, in assembly of an intact exosporium. Single and double mutants of B. cereus lacking ExsY and its paralogue, CotY, were constructed. The exsY mutant spores are not surrounded by an intact exosporium, though they often carry attached exosporium fragments. In contrast, the cotY mutant spores have an intact exosporium, although its overall shape is altered. The single mutants show altered, but different, spore coat properties. The exsY mutant spore coat is permeable to lysozyme, whereas the cotY mutant spores are less resistant to several organic solvents than is the case for the wild type. The exsY cotY double-mutant spores lack exosporium and have very thin coats that are permeable to lysozyme and are sensitive to chloroform, toluene, and phenol. These spore coat as well as exosporium defects suggest that ExsY and CotY are important to correct formation of both the exosporium and the spore coat in B. cereus. Both ExsY and CotY proteins were detected in Western blots of purified wild-type exosporium, in complexes of high molecular weight, and as monomers. Both exsY and cotY genes are expressed at late stages of sporulation. Endospores of the Bacillus cereus family, which includesBacillus anthracis and Bacillus thuringiensis, are enveloped by a large, balloon-like layer known as the exosporium (11,19). B. subtilis, the paradigm sporeformer, does not have this distinct layer, although the B. subtilis spore coat may have a tight-fitting outermost layer that can be visualized after extraction of coat material with urea or mercaptoethanol (23). Scanning electron microscopy has revealed that the exosporium is composed of two layers-a paracrystalline basal layer with hexagonal periodicity and a "hairy nap" outer layer (11). The exosporium is chemically complex and is composed of 53% protein, 20% amino and neutral polysaccharides, 18% lipids, and ϳ4% ash (17).Multiple proteins from the exosporium of both B. cereus and B. anthracis have been identified (22,24,31); the majority do not have homologues in B. subtilis. For example, the surface layers of B. cereus, B. anthracis, and B. thuringiensis spores all contain glycoproteins with characteristic collagen-like repeat regions (5,10,27). Of these, the B. anthracis glycoprotein BclA is an essential component of the hairy nap layer of the exosporium (27, 29).Analysis of genome sequence information from B. cereus ATCC 14579 and B. anthracis Ames identified a cluster of genes near bclA implicated in exosporium production, including the region whose genes were designated yjbX-exsYyjcA-yjcB-exsFA-cotY (31). The ExsY and CotY proteins are homologues (ca. 35% amino acid identity) of the B. subtilis coat proteins CotY and CotZ (37). ExsY and CotY proteins have both been detected in purified exosporium from B. anthracis endospores by N-terminal sequencing of separated peptides (22). ExsY and CotY are very sim...

show abstract

Section: Methodsmentioning

confidence: 99%

ExsY and CotY Are Required for the Correct Assembly of the Exosporium and Spore Coat of Bacillus cereus

et al. 2006

View full text Add to dashboard Cite

show abstract

Genome organization is not conserved between Bacillus cereus and Bacillus subtilis

Økstad¹,

Hegna²,

Lindbäck³

et al. 1999

Microbiology

View full text Add to dashboard Cite

The opportunistic pathogen Bacillus cereus is the genetically stable member of a group of closely related bacteria including the insect pathogen Bacillus thuringiensis and the mammalian pathogen Bacillus anthracis. Physical maps of B. cereus and B. thuringiensis strains show considerable variations in discrete parts of the chromosome, suggesting that certain genome regions are more prone to rearrangements. B. cereus belongs to the same subgroup of Bacillus species as Bacillus subtilis, b y both phenotypic and rRNA sequence classification. The analysis of 80 kb of genome sequence sampled from different regions of the B. cereus ATCC 10987 chromosome is reported. Analysis of the sequence and comparison of the localization of the putative genes with that of B. subtilis orthologues show the following: (1) gene organization is not conserved between B. cereus and B. subtilis; (2) several putative genes are more closely related to genes from other bacteria and archaea than to B. subtilis, or may be absent in B. subtilis 168; (3) B. cereus contains a 155 bp repetitive sequence that is not present in B. subtilis. By hybridization, this repeat is present in all B. cereus and B. thuringiensis strains so far investigated.Keywords : comparative genome analysis, gene organization, repeated sequence, Bacillus cereus, Bacillus subtilis INTRODUCTIONSeveral studies in comparative genomics using whole genomes have been performed. These have focused mainly on distantly related bacteria Tatusov et al., 1996; Kolst~r, 1997; Smith et al., 1997). In addition, the close relatives Mycoplasma genitalium and Mycoplasrna pneumoniae have been analysed (Himmelreich et al., 1997). By sequence comparison, the Mycoplasma genomes could be subdivided into six DNA segments which were ordered differently in the two species, suggested to have originated by translocation via homologous recombination. The order of the genes within each segment was conserved, and the increased size of the M . pneumoniae chromosome appeared to be due mainly to gene duplications (Himmelreich et al., 1997).Bacillus cereus is a Gram-positive, rod-shaped, endospore-forming bacterium commonly found in soil, air The EMBL accession numbers for the sequences reported in this paper are specified in Table 1.-~~ 0002-2947 0 1999 SGM and water, and is a frequent cause of food-related diseases (Drobniewski, 1993). It is also an opportunistic pathogen involved in local and systemic infections. The pathogenicity of B. cereus is caused by its synthesis of several virulence factors, including a putative collagenase, phospholipases, haemolysins, diarrhoeagenic enterotoxins and emetic toxin (Drobniewski, 1993).Bacillus thuringiensis is distinguished from B. cereus by its production of insecticidal crystal toxins (reviewed by Aronson, 1993). Both species belong to the B. cereus group, which also includes the closely related Bacillus anthracis and Bacillus mycoides. Accumulated data have suggested that B. cereus should be considered the parent species of the group, and that the other species ...

show abstract

Twelve-Transmembrane-Segment (TMS) Version (ΔTMS VII-VIII) of the 14-TMS Tet(L) Antibiotic Resistance Protein Retains Monovalent Cation Transport Modes but Lacks Tetracycline Efflux Capacity

et al. 2001

View full text Add to dashboard Cite

show abstract

Insertional inactivation of a Tet(K)/Tet(L) like transporter does not eliminate tetracycline resistance in Bacillus cereus

Cited by 3 publications

References 19 publications

ExsY and CotY Are Required for the Correct Assembly of the Exosporium and Spore Coat of Bacillus cereus

ExsY and CotY Are Required for the Correct Assembly of the Exosporium and Spore Coat of Bacillus cereus

Genome organization is not conserved between Bacillus cereus and Bacillus subtilis

Twelve-Transmembrane-Segment (TMS) Version (ΔTMS VII-VIII) of the 14-TMS Tet(L) Antibiotic Resistance Protein Retains Monovalent Cation Transport Modes but Lacks Tetracycline Efflux Capacity

Contact Info

Product

Resources

About