Insertional mutagenesis in the zoonotic pathogen Chlamydia caviae

Abstract

The ability to introduce targeted genetic modifications in microbial genomes has revolutionized our ability to study the role and mode of action of individual bacterial virulence factors. Although the fastidious lifestyle of obligate intracellular bacterial pathogens poses a technical challenge to such manipulations, the last decade has produced significant advances in our ability to conduct molecular genetic analysis in Chlamydia trachomatis, a major bacterial agent of infertility and blindness. Similar approaches have not been established for the closely related veterinary Chlamydia spp., which cause significant economic damage, as well as rare but potentially life-threatening infections in humans. Here we demonstrate the feasibility of conducting site-specific mutagenesis for disrupting virulence genes in C. caviae, an agent of guinea pig inclusion conjunctivitis that was recently identified as a zoonotic agent in cases of severe community-acquired pneumonia. Using this approach, we generated C. caviae mutants deficient for the secreted effector proteins IncA and SinC. We demonstrate that C. caviae IncA plays a role in mediating fusion of the bacteria-containing vacuoles inhabited by C. caviae. Moreover, using a chicken embryo infection model, we provide first evidence for a role of SinC in C. caviae virulence in vivo.

Pmp Repertoires Influence the Different Infectious Potential of Avian and Mammalian Chlamydia psittaci Strains

“…To address the varying infectious potential among C. psittaci strains, we directly compared the infectious ability of four strains of different origin, two avian strains (6BC and 09DC77) and two strains isolated from mammals (02DC15 and 08DC60). The chicken embryo is a valuable and safe in vivo model that had been used to investigate virulence of bacterial, fungal and viral pathogens, including Chlamydia species ( Braukmann et al, 2012 ; Andersson et al, 2015 ; Filcek et al, 2019 ). Inoculation of chlamydiae at the chorioallantoic membrane (CAM) resembles a natural infection route across epithelial cells and is able to elicit a pronounced inflammatory response ( Braukmann et al, 2012 ).…”

Modeling of variables in cellular infection reveals CXCL10 levels are regulated by human genetic variation and the Chlamydia-encoded CPAF protease

“…The predicted target site closest to the start codon of CTL0233 (between nucleotides 35 and 36) was chosen. The primers IBS-CTL0233 (5′- AAAAAAGCTTATAATTATCCTTAATTACCGCTTACGTGCGCCCAGATAGGGTG-3′), EBS1d-CTL0233 (5′- CAGATTGTACAAATGTGGTGATAACAGATAAGTCGCTTACCTTAACTTACCTTTCTTTGT-3′), EBS2-CTL0233 (5′- TGAACGCAAGTTTCTAATTTCGGTTGTAATCCGATAGAGGAAAGTGTCT-3′), and EBS universal (Sigma-Aldrich) were used to retarget vector pDFTT3-CAT 65 for disruption of CTL0233. The resulting vector pDFTT3-CAT-CTL0233 was transformed into C. trachomatis LGV-L2 using the CaCl 2 -mediated approach 66 , with modifications described recently 67 .…”

Bacterial nucleomodulins: A coevolutionary adaptation to the eukaryotic command center

“…Unlike the currently known Chlamydia effector proteins, SinC possesses 2 unique properties. First, SinC is found to localize to the inner nuclear membrane during the late stages of infection where it interacts with the nucleoporin ELYS, lamin B1, LEM (LAP2, emerin, MAN1) domain proteins, lamin-associated polypeptide 1 (LAM1), and lamin B receptor (LBR) [ 133 , 134 ]. Due to SinC lacking a predicted NLS or transmembrane domain, the mechanism of its nuclear translocation has yet to be determined [ 131 ].…”

“…Due to SinC lacking a predicted NLS or transmembrane domain, the mechanism of its nuclear translocation has yet to be determined [ 131 ]. Second, SinC undergoes intercellular transmission to neighboring cells, where it will localize to the host cell inner nuclear membrane [ 131 , 133 ]. During studies with HeLa and HEK293 cells, SinC was found to specifically target 4 inner nuclear membrane proteins (emerin, MAN1, LAP1, and LBR) [ 131 ].…”

“…Because emerin, MAN1, LAP1, and LBR play a major role in regulating nuclear structure and chromatin organization, it is speculated that SinC interacts with these proteins to indirectly alter chromatin structure and silence specific host response genes [ 131 , 135 ]. While SinC orthologues with similar function have been identified in Chlamydia caviae and Chlamydia abortus , the SinC orthologue of the well-known Chlamydia trachomatis does not localize to the nuclear envelope [ 133 , 136 , 137 ]. Injection of SinC into the host cell cytosol modulates gene expression in infected and neighboring host cells, promoting virulence and pathogenicity of C .…”