Insights into the effect of mixed engineered nanoparticles on activated sludge performance

Abstract

In this study, the effects, fate and transport of ENPs in wastewater treatment plants (WWTP) were investigated using three parallel pilot WWTPs operated under identical conditions. The WWTPs were spiked with (i) an ENP mixture consisting of silver oxide, titanium dioxide and zinc oxide, and (ii) bulk metal salts. The third plant served as control (unspiked). ENP effects were evaluated for (i) bulk contaminant removal, (ii) activated sludge (AS) process performance, (iii) microbial community structure and dynamics and (iv) microbial inhibition. ENPs showed a strong affinity for biosolids and induced a specific oxygen uptake rate two times higher than the control. The heterotrophic biomass retained its ability to nitrify and degrade organic matter. However, non-recovery of ammonia- and nitrite-oxidizing bacteria such as Nitrosomonas, Nitrobacter or Nitrospira in the ENP spiked reactors suggests selective inhibitory effects. The results further suggest that ENPs and metal salts have antimicrobial properties which can reduce synthesis of extracellular polymeric substances and therefore floc formation. Scanning electron microscopy evidenced selective damage to some microbes, whereas lipid fingerprinting and 454 pyrosequencing indicated a temporal shift in the microbial community structure and diversity. Acidovorax, Rhodoferax, Comamonas and Methanosarcina were identified as nano-tolerant species. Competitive growth advantage of the nano-tolerant species influenced the removal processes and unlike other xenobiotic compounds, ENPs can hasten the natural selection of microbial species in AS.

Impact of Zinc Oxide Nanoparticles Amended Organic Manure on Arachis hypogaea Growth Response and Rhizosphere Bacterial Community

“…The composition of complex matrices such as the soil and wastewater either enhance or attenuate the inhibitory/toxic effect of ENPs. The increase in OUR induced by the ZnO nanoparticles is consistent with prior studies in which a combination of zinc, titanium and silver nanoparticles enhanced the oxygen uptake rate of microorganisms in wastewater treatment plant [40]. The increase in OUR was probably a response by the organisms to physiological stress.…”

Treatment of Hazardous Engineered Nanomaterials by Supermagnetized α-Cellulose Fibers of Renewable Paper-Waste Origin

“…The rising concentration of nanomaterials in wastewater, considerable toxicity, and long-term persistence in a real-world environment are serious concerns. , A standard wastewater treatment procedure used for remediation of various pollutants appears to be poorly suitable to the remove of ENMs from wastewater . Thus, individual NMs in real-world water can change their behavior regarding aggregation, agglomeration, and sedimentation of oxide particles .…”

Understanding microbial ecology can help improve biogas production in AD

“…The microbial diversity and dynamics of the digesters was investigated by extracting total genomic DNA from 200 mg wet weight digestate samples using a MoBio Power Soil kit (MO BIO Laboratories, Inc, UK). Samples were then processed for NGS by 454-Pyrosequencing on the GS FLX System (Roche) as described in Eduok et al (2015) using the following primers: for amplification of the bacterial 16S rRNA gene PCR primers were adapted for 454 amplicon sequencing by attaching the M13 adapter (italics) to the target forward primer M13-16S-IA-FL (5'-CACGACGTTGTAAAACGACCATGCTGCCTCCCGTAGGAGT-3'), whereas the 25-mer Lib-L specific sequence adapter B (italics ) was followed by the reverse template specific primer sequence 16S-IA-RL (5'-CCTATCCCCTGTGTGCCTTGGCAGTCTCAGAGAGTTTGATCCTGGCTCAG -3'). For amplification of the archaeal 16S rRNA gene PCR primers ARC-344F (5'-…”