Insulation of a conditionally expressed transgene in an adenoviral vector

Vassaux, Georges; Hurst, Helen C.; Lemoine, N. R.

doi:10.1038/sj.gt.3300910

Cited by 63 publications

(42 citation statements)

References 16 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This extra length may function as an insulator capable of blocking the transcriptional interference of upstream adenoviral sequences. 34,35 To demonstrate the utility of the 1.2 kb EGP-2 promoter, we utilized the truncated promoter to drive the expression of the suicide gene SR39TK. SR39TK can convert the nontoxic prodrug GCV resulting in toxic metabolites, ultimately causing cell death and displays a superior sensitivity to GCV compared to wild-type TK.…”

Section: Discussionmentioning

confidence: 99%

The carcinoma-specific epithelial glycoprotein-2 promoter controls efficient and selective gene expression in an adenoviral context

et al. 2005

View full text Add to dashboard Cite

Adenoviral vectors are widely used in cancer gene therapy. After systemic administration however, the majority of the virus homes to the liver and the expressed transgene may cause hepatotoxicity. To restrict transgene expression to tumor cells, tumor-or tissuespecific promoters are utilized. The tumor antigen epithelial glycoprotein-2 (EGP-2), also known as Ep-CAM, is expressed in many cancers from different epithelial origins. In this study, the EGP-2 promoter was shown to restrict the expression of luciferase and thymidine kinase in an adenoviral context in different cell lines. In vivo, the EGP-2 promoter mediated efficient expression of luciferase in tumors but showed a 3-log lower activity in liver tissue when compared with the cytomegalovirus (CMV) promoter. Similarly, the EGP-2 promoter mediated specific cell killing after ganciclovir treatment in EGP-2-positive cells. Moreover, in vivo, this treatment regiment did not cause any rise in the liver enzymes aspartate aminotransferase (ASAT) and alanine aminotransferase (ALAT), demonstrating absence of liver toxicity. In contrast, CMV-mediated expression of thymidine kinase in combination with ganciclovir treatment resulted in high ASAT and ALAT values. This study demonstrates the value of the EGP-2 promoter to restrict transgene expression to a broad range of tumor types, thereby preventing liver toxicity.

show abstract

Section: Discussionmentioning

confidence: 99%

The carcinoma-specific epithelial glycoprotein-2 promoter controls efficient and selective gene expression in an adenoviral context

et al. 2005

View full text Add to dashboard Cite

show abstract

“…33 As well as other viruses that use intrinsic properties of the transformed phenotype as the basis for tumourselective replication of a virus, 34 other replication-competent viruses will enter clinical trials based on the use of tumour/tissue-specific transcriptional regulatory elements to drive expression of the critical viral genes required for replication. 35 With a strongly established literature on the use of tissue/tumour-specific promoters within recombinant vectors 36,37 this is a field which is set to proliferate rapidly within the coming years.…”

Section: Gene Therapymentioning

confidence: 99%

Cancer gene therapy: hard lessons and new courses

2000

Self Cite

View full text Add to dashboard Cite

“…The cassette was flanked by insulator sequences ( bovine growth hormone transcription stop signals ) present in the plasmid pcDNA3 (bp 1000 ± 1250 ). 35 This fragment was obtained either by digestion of pcDNA3 (Invitrogen, Carlsbad, CA ) with PvuII and NotI, or by polymerase chain reaction (PCR ) amplification using the primers 5 H TTAGAATTCATAGTGTCACCTAAATGCTAG 3 H and 5 H AGCCGGTACCATCCCCAGCATGCCTGCTAT-TG 3 H . One copy of each of these insulators was subcloned into BamHI and EcoRI sites of pACpL +loxP, respectively.…”

Section: Construction and Verification Of Adehhrkmentioning

confidence: 99%

“…34 The cassette was flanked by insulator sequences (bovine growth hormone transcription stop signal) to avoid the interference of surrounding viral enhancers and promoters. 35 The final shuttle plasmid was named pACEHhrk. A schematic representation of the viral genome is shown in Figure 3A.…”

Section: Construction Of An E1 -Deleted Adenovirus For the Regulated mentioning

confidence: 99%

Evaluation of a new dual-specificity promoter for selective induction of apoptosis in breast cancer cells

et al. 2001

View full text Add to dashboard Cite

The conditional expression of lethal genes in tumor cells is a promising gene therapy approach for the treatment of cancer. The identification of promoters that are preferentially active in cancer cells is the starting point for this strategy. The combination of tissue -specific and tumor -specific elements offers the possibility to artificially develop such promoters. We describe the construction and characterization of a hybrid promoter for transcriptional targeting of breast cancer. In many cases, breast cancer cells retain the expression of estrogen receptors, and most solid tumors suffer from hypoxia as a consequence of their aberrant vascularization. Estrogen response elements and hypoxia -responsive elements were combined to activate transcription in cells that present at least one of these characteristics. When a promoter containing these elements is used to control the expression of the pro -apoptotic gene harakiri, the induction of cell death can be activated by estrogens and hypoxia, and inhibited by antiestrogens such as tamoxifen. Finally, we show evidence that these properties are maintained in the context of an adenoviral vector ( AdEHhrk ). Therefore, infection with this virus preferentially kills estrogen receptor ± positive breast cancer cells, or cells growing under hypoxic conditions. We propose the use of this promoter for transcriptional targeting of breast cancer. Cancer Gene Therapy ( 2001 ) 8, 298 ± 307

show abstract

Insulation of a conditionally expressed transgene in an adenoviral vector

Cited by 63 publications

References 16 publications

The carcinoma-specific epithelial glycoprotein-2 promoter controls efficient and selective gene expression in an adenoviral context

The carcinoma-specific epithelial glycoprotein-2 promoter controls efficient and selective gene expression in an adenoviral context

Cancer gene therapy: hard lessons and new courses

Evaluation of a new dual-specificity promoter for selective induction of apoptosis in breast cancer cells

Contact Info

Product

Resources

About