Intact NYN/PIN-Like Domain is Crucial for the Degradation of Inflammation-Related Transcripts by ZC3H12D

Abstract

ZC3H12D belongs to a recently discovered family of proteins containing four members of which the most studied and best described is the RNase ZC3H12A (MCPIP1/Regnase-1). ZC3H12A is a crucial negative regulator of inflammation. It accelerates the turnover of transcripts of a spectrum of proinflammatory cytokines, as well as its own mRNA. The biological role of ZC3H12D is less clear, although it was shown that this member of ZC3H12 family is also involved in the regulation of inflammation. Here, we show that ZC3H12A and ZC3H12D recognize a set of common target mRNAs encoding proteins that play important roles in the course of the inflammation. Similarly to ZC3H12A, ZC3H12D participates in the 3'UTR-dependent regulation of the turnover of mRNAs encoding interleukin-6 (IL-6), tumor necrosis factor (TNF), and immediate early response 3 gene (IER3). The ZC3H12A mRNA is also among the identified ZC3H12D targets. Using the combination of immunofluorescence with single molecule RNA fluorescence in situ hybridization (smRNA FISH) we have shown that ZC3H12D protein interacts with the ZC3H12A transcript. The direct binding of these two molecules in vivo was further confirmed by RNA immunoprecipitation. Simultaneously, overexpression of ZC3H12D increases the turnover rate of transcripts containing ZC3H12A 3'UTR. Using reporter gene assays we have confirmed that the Asp95 residue present in the NYN/PIN-like domain is crucial for ZC3H12D biological activity. We have also revealed that ZC3H12D recognizes the same structural elements present in the 3'UTRs of the investigated transcripts, as ZC3H12A. J. Cell. Biochem. 118: 487-498, 2017. © 2016 Wiley Periodicals, Inc.

OKN-007 Increases temozolomide (TMZ) Sensitivity and Suppresses TMZ-Resistant Glioblastoma (GBM) Tumor Growth

“…When comparing combined TMZ + OKN treatment to TMZ alone ( Figure 5 B ), interesting downregulated genes are IGR1 (associated with shorter disease-free survival in patients whose tumors are ER positive and HER2 positive [56] ; IGF1R signaling pathway is very relevant in drug resistance [57] ), XIST (increased level associated with shorter survival and poorer prognosis [58] ), and PRKDC (prognostic biomarker for chemoresistance in breast cancer patients [59] ). Interesting upregulated genes include ZC3H12A (crucial negative regulator of inflammation [60] ) and RN7SK (potential antiproliferative and tumor-suppressive function [61] ).…”

ZC3H12B/MCPIP2, a new active member of the ZC3H12 family

“…Interesting is also the phenomenon of the regulation of Regnase-1 level by other members of the ZC3H12 family. All proteins from this family (including Regnase-1 itself) are able to degrade Regnase-1 transcript (Iwasaki et al 2011;Wawro et al 2016Wawro et al , 2017M Wawro, A Solecka, W Sowinska, et al, unpubl.). In the present study, we have shown that ZC3H12B interacts with Regnase-1 3 ′ UTR although we could not confirm its direct interaction with Regnase-1 mRNA using RIP.…”

“…Briefly, the V5-TC tag was excised with KpnI and NotI and the STreptagII-Flag tag was inserted by ligation of two phosphorylated and reannealed oligos (StrepFlagM2s: CCACCATGGCAAGCTGGAGCCACCCGCAGT TCGAAAAGGGTGCAGACTACAAAGACGATGACGACAAGCTT GC; StrepFlagM2s: GGCCGCAAGCTTGTCGTCATCGTCTTTG TAGTCTGCACCCTTTTCGAACTGCGGGTGGCTCCAGCTTGCC AT GGTGGGTAC spSBtet-GP was a gift from Eric Kowarz (Addgene plasmid #60495) (Kowarz et al 2015). The luciferase constructs (pmirGLO_IL-6-3 ′ UTR, pmirGLO_IL-6-3 ′ UTRΔCE, pmirGLO_ZC3H12A-3 ′ UTR, pmirGLO_VEGFA-3 ′ UTR, and pmir-GLO_IER3-3 ′ UTR) were described previously (Kochan et al 2016;Wawro et al 2016Wawro et al , 2017. The sequences of all used constructs were verified by Sanger sequencing (Genomed) and the expression of the recombinant proteins was confirmed by western blotting analysis.…”

“…Our knowledge of the biological roles played by other members of the ZC3H12 family is very limited, although it appears that these members are also involved in inflammatory processes. ZC3H12D (MCPIP4) participates in the degradation of proinflammatory mRNAs, such as the mRNAs of IL-2, IL-6, IL-10, TNF, IER3, and Regnase-1 (Zhang et al 2015;Wawro et al 2017). Similar to Regnase-1, the overexpression of ZC3H12D attenuates global protein ubiquitination and leads to the inhibition of the TLR2and TLR4-induced activation of JNK, ERK, and NF-κB signaling and TLR4-induced inflammatory gene expression in macrophages (Huang et al 2012).…”

ZC3H12A/MCPIP1/Regnase‐1‐related endonucleases: An evolutionary perspective on molecular mechanisms and biological functions

“…Zc3h12d is upregulated upon endotoxin exposure, and its knockdown leads to a strong increase in the levels of IL‐1β, IL‐6, and TNF‐α, as well as other transcripts encoding additional inflammatory factors . Degradation of these mRNAs depends on the intact RNase domain of Zc3h12d . Although Zc3h12a and Zc3h12d appear to target common transcripts and seem to interact by co‐immunoprecipitation, they act independently in degrading IL‐6 mRNA .…”