Integrin-FAK signaling rapidly and potently promotes mitochondrial function through STAT3

Visavadiya, Nishant P.; Keasey, Matthew P.; Razskazovskiy, Vladislav; Banerjee, Kalpita; Jia, Cuihong; Lovins, Chiharu; Wright, Gary L.; Hagg, Theo

doi:10.1186/s12964-016-0157-7

Cited by 66 publications

(66 citation statements)

References 94 publications

(126 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Our mutant data suggests that this very functionally important serine residue both protects cells against and is a target of ER stress. This phosphorylated form of STAT3 is known to be important for mitochondrial function in a non-transcriptional manner [22, 26, 43]. The role of ER stress-induced loss of pS727-STAT3 in mitochondrial failure is also suggested by our findings that it is more severe with TM than with TG treatments, and that TM causes more bioenergetic failure, mitophagy and cell death.…”

Section: Discussionsupporting

confidence: 56%

“…STAT3 null bEnd5 cells were produced by CRISPR-Cas9 technology as described previously [26]. Briefly, a STAT3 gRNA-Cas9 plasmid with a puromycin resistance gene was transfected into bEnd5 cells.…”

Section: Methodsmentioning

confidence: 99%

“…After 24 hours, cells were treated with 2 μg/ml puromycin for 4 days to remove non-transfected cells. Puromycin resistant cells were maintained for ∼14 days then screened by PCR and Western blotting to confirm STAT3 deletion [26]. Cells were passaged normally and used for reintroduction of STAT3 WT or mutant plasmids.…”

Section: Methodsmentioning

confidence: 99%

“…Fusion PCR reactions were performed with primers FWD:5′ CCC AAGCTT ACCATGGTGAGCAAGGGC 3′ and REV 5′ ACGCCGGAATTC TTTTAATTTAAAGAGGAACCTCTGGG ‘3. The resulting fragment was gel purified, confirmed by restriction digest, and directionally cloned into pcDNA 3.1 (+) vector before being transformed into DH5α E.Coli according to standard protocol [26]. The constitutionally active, phosphomimetic, STAT3 S727D mutant was generated using the Q5 mutagenesis kit (Cat# E0554S, NEB) according to manufacturer's instructions with the following PCR primers 5′ CCTGCCGATGGACCCCCGCACTT 3′, and REV 5′ TCAATGGTATTGCTGCAGGTC 3′.…”

Section: Methodsmentioning

confidence: 99%

“…Mitochondrial localized STAT3 is known to reduce mitochondrial damage markers such as calcium overload, ROS production and mitochondrial permeability transition pore (mPTP) formation [23-25]. We have found that antagonists of integrins, FAK, and STAT3 rapidly and substantially reduce mitochondrial bioenergetics leading to endothelial cell loss [26]. …”

Section: Introductionmentioning

confidence: 99%

See 4 more Smart Citations

Reduced FAK-STAT3 signaling contributes to ER stress-induced mitochondrial dysfunction and death in endothelial cells

Banerjee

Keasey

Razskazovskiy

et al. 2017

Cellular Signalling

Self Cite

View full text Add to dashboard Cite

Excessive endoplasmic reticulum (ER) stress leads to cell loss in many diseases, e.g., contributing to endothelial cell loss after spinal cord injury. Here, we determined whether ER stress-induced mitochondrial dysfunction could be explained by interruption of the focal adhesion kinase (FAK)-mitochondrial STAT3 pathway we recently discovered. ER stress was induced in brain-derived mouse bEnd5 endothelial cells by thapsigargin or tunicamycin and caused apoptotic cell death over a 72 h period. In concert, ER stress caused mitochondrial dysfunction as shown by reduced bioenergetic function, loss of mitochondrial membrane potential and increased mitophagy. ER stress caused a reduction in mitochondrial phosphorylated S727-STAT3, known to be important for maintaining mitochondrial function. Normal activation or phosphorylation of the upstream cytoplasmic FAK was also reduced, through mechanisms that involve tyrosine phosphatases and calcium signaling, as shown by pharmacological inhibitors, bisperoxovanadium (bpV) and 2-aminoethoxydiphenylborane (APB), respectively. APB mitigated the reduction in FAK and STAT3 phosphorylation, and improved endothelial cell survival caused by ER stress. Transfection of cells rendered null for STAT3 using CRISPR technology with STAT3 mutants confirmed the specific involvement of S727-STAT3 inhibition in ER stress-mediated cell loss. These data suggest that loss of FAK signaling during ER stress causes mitochondrial dysfunction by reducing the protective effects of mitochondrial STAT3, leading to endothelial cell death. We propose that stimulation of the FAK-STAT3 pathway is a novel therapeutic approach against pathological ER stress.

show abstract

Section: Discussionsupporting

confidence: 56%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Reduced FAK-STAT3 signaling contributes to ER stress-induced mitochondrial dysfunction and death in endothelial cells

Banerjee

Keasey

Razskazovskiy

et al. 2017

Cellular Signalling

Self Cite

View full text Add to dashboard Cite

show abstract

Role of bio‐flavonols and their derivatives in improving mitochondrial dysfunctions associated with pancreatic tumorigenesis

Sharma,

Arora,

Bansal

et al. 2024

Cell Biochemistry & Function

View full text Add to dashboard Cite

Mitochondria, a cellular metabolic center, efficiently fulfill cellular energy needs and regulate crucial metabolic processes, including cellular proliferation, differentiation, apoptosis, and generation of reactive oxygen species. Alteration in the mitochondrial functions leads to metabolic imbalances and altered extracellular matrix dynamics in the host, utilized by solid tumors like pancreatic cancer (PC) to get energy benefits for fast‐growing cancer cells. PC is highly heterogeneous and remains unidentified for a longer time because of its complex pathophysiology, retroperitoneal position, and lack of efficient diagnostic approaches, which is the foremost reason for accounting for the seventh leading cause of cancer‐related deaths worldwide. PC cells often respond poorly to current therapeutics because of dense stromal barriers in the pancreatic tumor microenvironment, which limit the drug delivery and distribution of antitumor immune cell populations. As an alternative approach, various natural compounds like flavonoids are reported to possess potent antioxidant and anticancerous properties and are less toxic than current chemotherapeutic drugs. Therefore, we aim to summarize the current state of knowledge regarding the pharmacological properties of flavonols in PC in this review from the perspective of mitigating mitochondrial dysfunctions associated with cancer cells. Our literature survey indicates that flavonols efficiently regulate cellular metabolism by scavenging reactive oxygen species, mitigating inflammation, and arresting the cell cycle to promote apoptosis in tumor cells via intrinsic mitochondrial pathways. In particular, flavonols proficiently inhibit the cancer‐associated proliferation and inflammatory pathways such as EGFR/MAPK, PI3K/Akt, and nuclear factor κB in PC. Overall, this review provides in‐depth evidence about the therapeutic potential of flavonols for future anticancer strategies against PC; still, more multidisciplinary human interventional studies are required to dissect their pharmacological effect accurately.

show abstract

Milk fat globule EGF factor 8 restores mitochondrial function via integrin‐medicated activation of the FAK‐STAT3 signaling pathway in acute pancreatitis

Ren¹,

Liu²,

Zhang³

et al. 2021

Clinical & Translational Med

View full text Add to dashboard Cite

Acute pancreatitis (AP) remains a significant clinical challenge. Mitochondrial dysfunction contributes significantly to the pathogenesis of AP. Milk fat globule EGF factor 8 (MFG‐E8) is an opsonizing protein, which has many biological functions via binding to αvβ3/5 integrins. Ligand‐dependent integrin‐FAK activation of STAT3 was reported to be of great importance for maintaining a normal mitochondrial function. However, MFG‐E8's role in AP has not been evaluated. Methods Blood samples were acquired from 69 healthy controls and 134 AP patients. Serum MFG‐E8 levels were measured by ELISA. The relationship between serum concentrations of MFG‐E8 and disease severity were analyzed. The role of MFG‐E8 was evaluated in experimental models of AP. Results Serum concentrations of MFG‐E8 were lower in AP patients than healthy controls. And serum MFG‐E8 concentrations were negatively correlated with disease severity in AP patients. In mice, MFG‐E8 administration decreased L‐arginine‐induced pancreatic injury and mortality. MFG‐E8's protective effects in experimental AP were associated with improvement in mitochondrial function and reduction in oxidative stress. MFG‐E8 knockout mice suffered more severe pancreatic injury and greater mitochondrial damage after l‐arginine administration. Mechanistically, MFG‐E8 activated the FAK‐STAT3 pathway in AP mice. Cilengitide, a specific αvβ3/5 integrin inhibitor, abolished MFG‐E8's beneficial effects in AP. PF00562271, a specific FAK inhibitor, blocked MFG‐E8‐induced STAT3 phosphorylation. APTSTAT3‐9R, a specific STAT3 antagonist, also eliminated MFG‐E8's beneficial effects under such a condition. Conclusions MFG‐E8 acts as an endogenous protective mediator in the pathogenesis of AP. MFG‐E8 administration protects against AP possibly by restoring mitochondrial function via activation of the integrin‐FAK‐STAT3 signaling pathway. Targeting the action of MFG‐E8 may present a potential therapeutic option for AP.

show abstract

Integrin-FAK signaling rapidly and potently promotes mitochondrial function through STAT3

Cited by 66 publications

References 94 publications

Reduced FAK-STAT3 signaling contributes to ER stress-induced mitochondrial dysfunction and death in endothelial cells

Reduced FAK-STAT3 signaling contributes to ER stress-induced mitochondrial dysfunction and death in endothelial cells

Role of bio‐flavonols and their derivatives in improving mitochondrial dysfunctions associated with pancreatic tumorigenesis

Milk fat globule EGF factor 8 restores mitochondrial function via integrin‐medicated activation of the FAK‐STAT3 signaling pathway in acute pancreatitis

Contact Info

Product

Resources

About