Interferon Alfa Subtypes and Levels of Type I Interferons in the Liver and Peripheral Mononuclear Cells in Patients With Chronic Hepatitis C and Controls

Castelruiz, Y.; Larrea, Esther; Boya, Patricia; Civeira, M.P.; Prieto, Jesús

doi:10.1002/hep.510290625

Cited by 52 publications

(42 citation statements)

References 34 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The data presented in this work are the first example of two closely related IFN-␣ subtypes with differential effects on both transcriptional events and function in human T lymphocytes. The physiological significance of this difference is not yet clear, but because different infections can induce different IFN-␣ subtypes (27,38), it is possible that differential production of different IFN-␣ subtypes leads to a qualitatively different inflammatory infiltrate, thus influencing the overall phenotype of the developing immune response. In vivo models will be required to address this possibility.…”

Section: Discussionmentioning

confidence: 99%

IFN-α Subtypes Differentially Affect Human T Cell Motility

Foster

Masri

David

et al. 2004

The Journal of Immunology

View full text Add to dashboard Cite

The type I IFN family includes 14 closely related antiviral cytokines that are produced in response to viral infections. They bind to a common receptor, and have qualitatively similar biological activities. The physiological relevance of this redundancy is still unclear. In this study, we analyzed and compared the effects of two potent antiviral type I IFNs, IFN-α2 and IFN-α8, on the motility of various populations of human T lymphocytes in vitro. In this study, we show that IFN-α2 induces chemokinesis of both CD4+ and CD8+ T cells at various stages of differentiation, and induces functional changes that result in enhanced T cell motility, including up-regulation of the integrins LFA-1 and VLA-4, and subsequently, increased ICAM-1- and fibronectin-dependent migration. In contrast, IFN-α8 did not affect T cell motility, despite having similar antiviral properties and similar effects on the induction of the antiviral protein MxA. However, transcription of other IFN-stimulated genes showed that transcription of these genes is selectively activated by IFN-α2, but not IFN-α8, in T cells. Finally, while the antiviral activity of the two subtypes is inhibited by Abs against the two subunits of the IFN-α receptor, the chemokinetic effect of IFN-α2 is selectively blocked by Abs against the A1 receptor subunit. These observations are consistent with the possibility that subtype-specific intracellular signaling pathways are activated by type I IFNs in T lymphocytes.

show abstract

Section: Discussionmentioning

confidence: 99%

IFN-α Subtypes Differentially Affect Human T Cell Motility

Foster

Masri

David

et al. 2004

The Journal of Immunology

View full text Add to dashboard Cite

show abstract

“…Total RNA was isolated from cell extracts using Ultraspect RNA isolation kit (Biotex, Houston, TX) following manufacturer's instructions. One microgram of RNA was reverse-transcribed as previously described (24) and the cDNA was amplified with Taq polymerase using specific primers for MuLV gp70 env (sense primer: ACCT TGTCCGAAGTGACCG, antisense primer: GTACCAATCCTGTGTG GTCG, to amplify a 594-bp fragment as described (18)) or for ␤-actin (sense primer: TCTACAATGAGCTGCGTGTG, antisense primer: GGT GAGGATCTTCATGAGGT, to amplify a 314-bp fragment as described (24)). Amplified cDNA was electrophoresed through 1% agarose and visualized under UV after ethidium bromide staining.…”

Section: Pcr Primers and Rt-pcrmentioning

confidence: 99%

CD4+/CD25+ Regulatory Cells Inhibit Activation of Tumor-Primed CD4+ T Cells with IFN-γ-Dependent Antiangiogenic Activity, as well as Long-Lasting Tumor Immunity Elicited by Peptide Vaccination

Casares

Arribillaga

Sarobe

et al. 2003

The Journal of Immunology

193

147

View full text Add to dashboard Cite

CD25+ regulatory T (T reg) cells suppress the activation/proliferation of other CD4+ or CD8+ T cells in vitro. Also, down-regulation of CD25+ T reg cells enhance antitumor immune responses. In this study, we show that depletion of CD25+ T reg cells allows the host to induce both CD4+ and CD8+ antitumoral responses following tumor challenge. Simultaneous depletion of CD25+ and CD8+ cells, as well as adoptive transfer experiments, revealed that tumor-specific CD4+ T cells, which emerged in the absence of CD25+ T reg cells, were able to reject CT26 colon cancer cells, a MHC class II-negative tumor. The antitumoral effect mediated by CD4+ T cells was dependent on IFN-γ production, which exerted a potent antiangiogenic activity. The capacity of the host to mount this antitumor response is lost once the number of CD25+ T reg cells is restored over time. However, CD25+ T reg cell depletion before immunization with AH1 (a cytotoxic T cell determinant from CT26 tumor cells) permits the induction of a long-lasting antitumoral immune response, not observed if immunization is conducted in the presence of regulatory cells. A study of the effect of different levels of depletion of CD25+ T reg cells before immunization with the peptide AH1 alone, or in combination with a Th determinant, unraveled that Th cells play an important role in overcoming the suppressive effect of CD25+ T reg on the induction of long-lasting cellular immune responses.

show abstract

“…CD4 ϩ CD25 ϩ cells obtained after in vitro stimulation of PBMC from different patients in the presence of 1 g of HCV core protein per ml were lysed for mRNA isolation as described before. mRNA was reverse transcribed as previously described (6). PCR amplifications were carried out using specific primers for ␤-glucuronidase (upper primer, CTCCGTATGTGGATGTGATC; lower primer, ATCCAGACCCAGATGGTACT, to amplify a 244-bp fragment located between nucleotides 1504 and 1748) or for ␤-actin (upper primer, TCTACAA TGAGCTGCGTGTG; lower primer, GGTGAGGATCTTCATGAGGT, to amplify a 314-bp fragment located between nucleotides 1319 and 2079) as described previously (6).…”

Section: Vol 76 2002 Abnormal T-cell Priming By DC Expressing Hcv Pmentioning

confidence: 99%

“…mRNA was reverse transcribed as previously described (6). PCR amplifications were carried out using specific primers for ␤-glucuronidase (upper primer, CTCCGTATGTGGATGTGATC; lower primer, ATCCAGACCCAGATGGTACT, to amplify a 244-bp fragment located between nucleotides 1504 and 1748) or for ␤-actin (upper primer, TCTACAA TGAGCTGCGTGTG; lower primer, GGTGAGGATCTTCATGAGGT, to amplify a 314-bp fragment located between nucleotides 1319 and 2079) as described previously (6). PCR-derived fragments were amplified by 30 cycles (20 s at 94°C, 15 s at 56°C, and 30 s at 72°C) for ␤-glucuronidase detection and by 25 cycles (20 s at 94°C, 15 s at 55°C, and 30 s at 72°C) for ␤-actin detection.…”

Section: Vol 76 2002 Abnormal T-cell Priming By DC Expressing Hcv Pmentioning

confidence: 99%

“…Amplified cDNA was electrophoresed through 1% agarose, visualized by UV after ethidium bromide staining, and quantified by image analysis using a commercial software (Molecular Analyst/PC; Bio-Rad, Hercules, Calif.). mRNA for ␤-actin had been previously shown to be constantly expressed in PBMC from chronic HCV patients (6). Results of ␤-glucuronidase expression for each patient were normalized with those of ␤-actin and were expressed as the ratio of ␤-glucuronidase expression to ␤-actin expression.…”

Section: Vol 76 2002 Abnormal T-cell Priming By DC Expressing Hcv Pmentioning

confidence: 99%

See 1 more Smart Citation

Abnormal Priming of CD4⁺T Cells by Dendritic Cells Expressing Hepatitis C Virus Core and E1 Proteins

Sarobe

Lasarte

Casares

et al. 2002

J Virol

143

View full text Add to dashboard Cite

Patients infected with hepatitis C virus (HCV) have an impaired response against HCV antigens while keeping immune competence for other antigens. We hypothesized that expression of HCV proteins in infected dendritic cells (DC) might impair their antigen-presenting function, leading to a defective anti-HCV T-cell immunity. To test this hypothesis, DC from normal donors were transduced with an adenovirus coding for HCV core and E1 proteins and these cells (DC-CE1) were used to stimulate T lymphocytes. DC-CE1 were poor stimulators of allogeneic reactions and of autologous primary and secondary proliferative responses. Autologous T cells stimulated with DC-CE1 exhibited a pattern of incomplete activation characterized by enhanced CD25 expression but reduced interleukin 2 production. The same pattern of incomplete lymphocyte activation was observed in CD4 ؉ T cells responding to HCV core in patients with chronic HCV infection. However, CD4؉ response to HCV core was normal in patients who cleared HCV after alpha interferon therapy. Moreover, a normal CD4 ؉ response to tetanus toxoid was found in both chronic HCV carriers and patients who had eliminated the infection. Our results suggest that expression of HCV structural antigens in infected DC disturbs their antigen-presenting function, leading to incomplete activation of anti-HCV-specific T cells and chronicity of infection. However, presentation of unrelated antigens by noninfected DC would allow normal T-cell immunity to other pathogens.Hepatitis C virus (HCV) is a single-stranded RNA virus belonging to the Flaviviridae family (25). Although some patients exhibit acute self-limited infection, a characteristic feature of HCV is the high incidence of persistent infection and chronic hepatitis, with a strong risk for the development of hepatocellular carcinoma (10). This high incidence of chronicity suggests that the virus has developed efficient mechanisms to escape host immune responses. Indeed, although most patients have anti-HCV antibodies (38), cellular immune responses are weak in chronically infected patients. It has been reported that CD4 ϩ T-cell responses against viral antigens are vigorous in individuals who have cleared HCV after acute infection or after treatment with alpha interferon (IFN-␣) (11,21,26,35). By contrast, patients who fail to respond to therapy exhibit poor T-cell reactivity against viral proteins. Regarding CD8 ϩ lymphocytes, low responses have been detected in infected patients (7,32,37), and recent reports show that these cells play a critical role during the acute phase of the disease (8). Thus, chronicity of HCV infection is related to the inability of HCV-specific CD4 ϩ and CD8 ϩ T cells to accomplish efficient effector functions. These defects, however, are not the result of general immunosuppression since T-cell immunity to other pathogens is well preserved in patients with chronic HCV infection.HCV may evade immune surveillance by different mechanisms including mutations in regions that are targets for the immune system (13,40,41)...

show abstract

Interferon Alfa Subtypes and Levels of Type I Interferons in the Liver and Peripheral Mononuclear Cells in Patients With Chronic Hepatitis C and Controls

Cited by 52 publications

References 34 publications

IFN-α Subtypes Differentially Affect Human T Cell Motility

IFN-α Subtypes Differentially Affect Human T Cell Motility

CD4+/CD25+ Regulatory Cells Inhibit Activation of Tumor-Primed CD4+ T Cells with IFN-γ-Dependent Antiangiogenic Activity, as well as Long-Lasting Tumor Immunity Elicited by Peptide Vaccination

Abnormal Priming of CD4⁺T Cells by Dendritic Cells Expressing Hepatitis C Virus Core and E1 Proteins

Contact Info

Product

Resources

About

Interferon Alfa Subtypes and Levels of Type I Interferons in the Liver and Peripheral Mononuclear Cells in Patients With Chronic Hepatitis C and Controls

Cited by 52 publications

References 34 publications

IFN-α Subtypes Differentially Affect Human T Cell Motility

IFN-α Subtypes Differentially Affect Human T Cell Motility

CD4+/CD25+ Regulatory Cells Inhibit Activation of Tumor-Primed CD4+ T Cells with IFN-γ-Dependent Antiangiogenic Activity, as well as Long-Lasting Tumor Immunity Elicited by Peptide Vaccination

Abnormal Priming of CD4+T Cells by Dendritic Cells Expressing Hepatitis C Virus Core and E1 Proteins

Contact Info

Product

Resources

About

Abnormal Priming of CD4⁺T Cells by Dendritic Cells Expressing Hepatitis C Virus Core and E1 Proteins