Intrinsic cellular signaling mechanisms determine the sensitivity of cancer cells to virus-induced apoptosis

Abstract

Cancer cells of epithelial and mesenchymal phenotypes exhibit different sensitivities to apoptosis stimuli, but the mechanisms underlying this phenomenon remain partly understood. We constructed a novel recombinant adenovirus expressing Ad12 E1A (Ad-E1A12) that can strongly induce apoptosis. Ad-E1A12 infection of epithelial cancer cells displayed dramatic detachment and apoptosis, whereas cancer cells of mesenchymal phenotypes with metastatic propensity were markedly more resistant to this virus. Notably, forced detachment of epithelial cells did not further sensitize them to Ad-E1A12-induced apoptosis, suggesting that cell detachment is a consequence rather than the cause of Ad-E1A12-induced apoptosis. Ad-E1A12 increased phosphorylation of AKT1 and ribosomal protein S6 through independent mechanisms in different cell types. Ad-E1A12–induced AKT1 phosphorylation was PI3K-dependent in epithelial cancer cells, and mTOR-dependent in mesenchymal cancer cells. Epithelial cancer cells upon Ad-E1A12-induced detachment could not sustain AKT activation due to AKT1 degradation, but AKT1 activation was maintained in mesenchymal cancer cells. Expression of epithelial cell-restricted miR-200 family in mesenchymal cells limited mTOR signaling and sensitized them to Ad-E1A12-induced cell killing. Thus, epithelial cancer cells rely on the canonical PI3K-AKT signaling pathway for survival, while mesenchymal cancer cells deploy the PI3K-independent mTORC2-AKT axis in response to strong death stimuli.

Inhibition of androgen receptor transactivation function by adenovirus type 12 E1A undermines prostate cancer cell survival

“…Inhibition of one pathway resulted in enhanced signaling of the other . Ad infection can activate the PI3K‐AKT‐mTOR pathway; we reported recently that Ad‐E1A12 infection markedly activates this pathway . We thus hypothesized that pharmacological inhibition of the PI3K‐AKT‐mTOR pathway could synergize with Ad‐E1A12 to kill PCa cells.…”

“…Compared to the cells infected with Ad‐eGFP, the ratio of nuclear to cytoplasmic AR was clearly higher in cells infected with Ad‐E1A12 (Figures A and B). Of note, the viral DBP was detected as a surrogate marker of Ad‐E1A12 infection, as the DBP expression strictly requires E1A12 expression . Thus, E1A12 266 aa was able to promote the nuclear entry of endogenous AR, although the potency to stimulate AR nuclear translocation by E1A12 266 aa was notably weaker than R1881 (Figure B).…”

“…The expression plasmids for wild‐type (wt) E1A12 and various mutants were reported previously . The full‐length AR (GFP‐AR, plasmid # 28235) and AR‐V7 (GFP‐AR‐V7, plasmid # 86856) fused to GFP were obtained from Addgene, Cambridge, MA.…”

“…FLAG‐tagged full‐length AR and constructs with a specific deletion within the AR NTD were described . Ad‐E1A12 and other viruses with mutated E1A12 were constructed as reported previously . Recombinant viruses were generated through homologous recombination between pShuttle‐CMV carrying the E1A12 expression cassette and pAdEasy‐1, an E1 , and E3 ‐deleted Ad vector (Agilent Technologies, Santa Clara, CA) .…”

“…cDNAs were synthesized from total RNAs using MultiScribe reverse transcriptase kit (Applied Biosystems, Foster City, CA), which were used as templates for real‐time PCR with the SYBR‐green detection method. Quantification was as described previously . The PCR primers were: AR (5′‐ CAGTGGATGGGCTGAAAAAT‐3′ and 5′‐GGAGCTTGGTGAGCTGGTAG‐3′); FKBP5 (5′‐ AGGAGGGAAGAGTCCCAGTG‐3′ and 5′‐TGGGAAGCTACTGGTTTTGC‐3′); ATAD2 (5′‐ TCAGGCTCCATTGGAAAAAC‐3′ and 5′‐CCTGCGGAAGATAATCGGTA‐3′); MYC (5′‐ AGCGACTCTGAGGAGGAACA‐3′ and 5′‐CTCTGACCTTTTGCCAGGAG‐3′); GLUD1 (5′‐ GGAGGTTCACCATGGAGCTA‐3′ and 5′‐CCTATGGTGCTGGCATAGGT‐3′); TFRC (5′‐ AAAATCCGGTGTAGGCACAG‐3′ and 5′‐CACCAACCGATCCAAAGTCT‐3′); and ACTB (5′‐ GCTCCTCCTGAGCGC AAGTACTC‐3′ and 5′ − GTGGACAGCGAGGCCAGGAT‐3′).…”