Investigation of the human pathogen Acinetobacter baumannii under iron limiting conditions

Abstract

BackgroundIron acquisition systems are important virulence factors in pathogenic bacteria. To identify these systems in Acinetobacter baumannii, the transcriptomic response of the completely sequenced strain ATCC 17978 under iron limiting conditions was investigated using a genomic microarray that contained probes for all annotated open reading frames.ResultsUnder low iron conditions, transcription levels were more than 2-fold up-regulated for 463 genes, including 95 genes that were up-regulated more than 4-fold. Of particular significance, three siderophore biosynthesis gene clusters, including one novel cluster, were highly up-regulated. Binding sites for the ferric uptake regulator were identified in the promoter regions of many up-regulated genes, suggesting a prominent role for this regulator in the Acinetobacter iron acquisition response. Down-regulation under iron limitation was less dramatic as the transcription of only 202 genes varied more than 2-fold. Various genes involved in motility featured prominently amongst the genes down-regulated when iron was less readily available. Motility assays confirmed that these transcriptional changes are manifested at the phenotypic level. The siderophore biosynthesis gene clusters were further investigated by means of comparative genomic analysis of 10 sequenced Acinetobacter isolates. These analyses revealed important roles for mobile genetic elements in shaping the siderophore meditated iron acquisition mechanisms between different Acinetobacter strains.ConclusionsA. baumannii grown under iron limited conditions resulted in major transcriptional changes of not only many iron acquisition related genes, but also genes involved in other processes such as motility. Overall, this study showed that A. baumannii is well adaptable to growth in an environment which has limiting iron availability.

Structure and Function of the PiuA and PirA Siderophore-Drug Receptors from Pseudomonas aeruginosa and Acinetobacter baumannii

“…The BLAST algorithm identified two uncharacterized open reading frames (ORFs), A1S_0474 and A1S_0980 (ATCC 17978 numbering), as the closest hits, sharing amino acid identities of 44% with PiuA and 51% with PirA of P. aeruginosa, respectively. Both genes have been shown to be preceded by putative Fur binding sites (A1S_0474, GCGAATAATAATAATTCTTATTTAT, and A1S_0980, GATATTGTTAATAATTATC ATTATT) (33), suggesting regulation by iron availability via the Fur iron uptake regulator. Downstream of the piuA gene of A. baumannii, we identified an ORF (A1S_0473) showing 52% amino acid identity with piuC from P. aeruginosa and ybiX from Escherichia coli (Fig.…”

“…2). A transcriptome analysis performed in A. baumannii strain ATCC 17978 recently showed that expression of both piuA and pirA is induced under iron-limiting conditions (33). A. baumannii strains harbor at least three distinct siderophore clusters, one of them being the acinetobactin biosynthesis operon.…”

Transcriptomic and biochemical analyses identify a family of chlorhexidine efflux proteins

“…A custom-designed 8× 15,000 spot Agilent microarray for A. baumannii ATCC 17978 described was used (28). cDNA synthesis, labeling, and hybridizations were conducted at the Ramaciotti Centre for Gene Function Analysis, Australia, as described (28). Statistical analyses were performed by using the SAM algorithms (29), and all results reported were found to be significant by using a false discovery rate of 5%.…”

“…A custom-designed 8× 15,000 spot Agilent microarray for A. baumannii ATCC 17978 described was used (28). cDNA synthesis, labeling, and hybridizations were conducted at the Ramaciotti Centre for Gene Function Analysis, Australia, as described (28).…”

“…Cultures were allowed to grow for an additional 30 min (to an average final OD 600 ∼ 1.35 for untreated cells and 1.25 for chlorhexidinetreated samples), when cells were harvested by centrifugation and immediately suspended in TRIzol reagent (Invitrogen). Total RNA was extracted as described (28).…”