Involvement of Akt in ER-to-Golgi Transport of SCAP/SREBP: A Link between a Key Cell Proliferative Pathway and Membrane Synthesis

Abstract

Akt is a critical regulator of cell growth, proliferation, and survival that is activated by phosphatidylinositol 3-kinase (PI3K). We investigated the effect of PI3K inhibition on activation of sterol regulatory element binding protein-2 (SREBP-2), a master regulator of cholesterol homeostasis. SREBP-2 processing increased in response to various cholesterol depletion approaches (including statin treatment) and this increase was blunted by treatment with a potent and specific inhibitor of PI3K, LY294002, or when a plasmid encoding a dominant-negative form of Akt (DN-Akt) was expressed. LY294002 also suppressed SREBP-2 processing induced by insulin-like growth factor-1. Furthermore, LY294002 treatment down-regulated SREBP-2 or -1c gene targets and decreased cholesterol and fatty acid synthesis. Fluorescence microscopy studies indicated that LY294002 disrupts transport of the SREBP escort protein, SCAP, from the endoplasmic reticulum to the Golgi. This disruption was also shown by immunofluorescence staining when DN-Akt was expressed. Taken together, our studies indicate that the PI3K/Akt pathway is involved in SREBP-2 transport to the Golgi, contributing to the control of SREBP-2 activation. Our results provide a crucial mechanistic link between the SREBP and PI3K/Akt pathways that may be reconciled teleologically because synthesis of new membrane is an absolute requirement for cell growth and proliferation.

Transcriptional Control of Cholesterol Biosynthesis in Schwann Cells by Axonal Neuregulin 1

“…It is possible that the sustained overstimulation of the PI3K pathway by myr-Akt activates to saturation the HMGR promoter by a CRE-independent mechanism. In this way, it is interesting to point out that PI3K/Akt pathway activation in Chinese hamster ovary cells promotes as well the transcription of the HMGR promoter by stimulating SREBP processing and ERto-Golgi transport of SCAP (28). In summary, our data support the tenet that the activation of the PI3K pathway by extracellular signaling molecules up-regulates cholesterol biosynthesis in myelin-forming cells, both by CRE-dependent and CRE-independent mechanisms.…”

“…However, we also found that the deletion of the CRE in the HMGR reductase promoter did not reduce the myr-Akt-dependent transcriptional activity (Fig. 5d), suggesting that the sustained activation of Akt is able to induce the HMGR promoter at saturation level by a CREindependent mechanism (28).…”

Cholesterol-mediated Degradation of 7-Dehydrocholesterol Reductase Switches the Balance from Cholesterol to Vitamin D Synthesis

“…Gene expression levels of Insig-1, Insig-2, and DHCR7 were determined and normalized to the housekeeping gene porphobilinogen deaminase (PBGD). Primer sequences for PBGD have been published previously (22,23). Insig-1 primer sequences were CGCCTGTTGCAGAGGAGCC (forward) and CGAGGTGACTGTCGATACAGGG (reverse), Insig-2 primers were CGCTCTTTCCACCTGATGTG (forward) and CAGTCCAATGGATAGTGCAGCC (reverse), and DHCR7 primers were CACCGGCCGTGCTAGTCTGG (forward) and CAGGCTTGTAGCCCGTTCACCTC (reverse).…”

Evolutionary conservation and adaptation in the mechanism that regulates SREBP action: what a long, strange tRIP it's been

“…Insulin signaling activates AKT, which has been reported to be directly involved in the movement of SREBP-SCAP from the ER to Golgi ( Fig. 2; Du et al 2006;Yellaturu et al 2009). The precursor SREBP-1c protein is also a substrate for AKT phosphorylation in vitro (Yellaturu et al 2009).…”