Involvement of Amylin and Leptin in the Development of Projections from the Area Postrema to the Nucleus of the Solitary Tract

Abstract

The area postrema (AP) and the nucleus of the solitary tract (NTS) are important hindbrain centers involved in the control of energy homeostasis. The AP mediates the anorectic action and the inhibitory effect on gastric emptying induced by the pancreatic hormone amylin. Amylin’s target cells in the AP project to the NTS, an integrative relay center for enteroceptive signals. Perinatal hormonal and metabolic factors influence brain development. A postnatal surge of the adipocyte-derived hormone leptin represents a developmental signal for the maturation of projections between hypothalamic nuclei controlling energy balance. Amylin appears to promote neurogenesis in the AP in adult rats. Here, we examined whether amylin and leptin are required for the development of projections from the AP to the NTS in postnatal and adult mice by conducting neuronal tracing studies with DiI in amylin- (IAPP−/−) and leptin-deficient (ob/ob) mice. Compared to wild-type littermates, postnatal (P10) and adult (P60) IAPP−/− mice showed a significantly reduced density of AP-NTS projections. While AP projections were also reduced in postnatal (P14) ob/ob mice, AP-NTS fiber density did not differ between adult ob/ob and wild-type animals. Our findings suggest a crucial function of amylin for the maturation of neuronal brainstem pathways controlling energy balance and gastrointestinal function. The impaired postnatal development of neuronal AP-NTS projections in ob/ob mice appears to be compensated in this experimental model during later brain maturation. It remains to be elucidated whether an amylin- and leptin-dependent modulation in neuronal development translates into altered AP/NTS-mediated functions.

Amylin Selectively Signals Onto POMC Neurons in the Arcuate Nucleus of the Hypothalamus

“…However, the exact time period by which amylin exerts its neurotrophic action during the formation of the ARC-PVN pathways remains to be determined. It is known that postnatal amylin levels are similar to levels in adult animals and there is no amylin "surge" similar to that seen for leptin between P6 and P10 (51). Also, amylin is cosecreted with insulin by the pancreatic b-cells, and insulin secretion starts at embyonic day 12 and increases progressively until birth (52).…”

Endogenous amylin contributes to birth of microglial cells in arcuate nucleus of hypothalamus and area postrema during fetal development

“…Heterozygous amylin breeding pairs on a C57BL/6 background were generated from frozen embryos derived from the original mouse strain developed by Gebre-Medhin et al (1,19). Founder animals that were used to generate the breeders for the present study were provided by Amylin Pharmaceuticals (San Diego, CA).…”

“…Genotype-specific pairs of primers were used, resulting in a 200-bp (amylin Ϫ/Ϫ ) and 107-bp (amylin ϩ/ϩ ) amplicon; heterozygous animals showed both bands. The 5=-3= primer sequences were the following: CTTGGGTGGAGAGGCTATTC and CACAGCTGCGCAAGGAAC for amylin Ϫ/Ϫ ; and GTAGCAACCCTCAGATGGAC and GAG-GACTGGACCAAGGTTGT for amylin ϩ/ϩ , respectively (1,19).…”

“…Amylin also acts in the arcuate nucleus (ARC) of the hypothalamus to increase leptininduced pSTAT3 by inducing the secretion of microglial interleukin (IL)-6, which enhances neuronal pSTAT3 signaling by binding to the neuronal receptor gp130 (33). Furthermore, endogenous amylin has been identified as a neurotrophic factor in the caudal hindbrain and the hypothalamus during the perinatal period using DiI staining (1), indicating that amylin is involved in the maturation of brain circuits by enhancing the development of axonal fibers in fore-and hindbrain nuclei, i.e., ARC to paraventricular nucleus (PVN) of the hypothalamus and AP to nucleus tractus solitarius (1). Using various genetically modified mouse models, we have shown more specifically that amylin acts in the ARC on proopiomelanocortin (POMC) and agouti-related protein (AgRP) neurons to promote the development of ␣-MSH and AgRP immunoreactive fibers to the PVN, respectively (33).…”

“…With the current increase in worldwide childhood obesity (17), it is important to identify factors that might play a role during embryogenesis, since impairment of brain development during the perinatal period has been shown to lead to lifelong metabolic alterations (13,28,41). Amylin plays a role in the regulation of energy homeostasis, and 18-wk-old male amylin KO mice display a higher body weight than WT controls (1,19) and have an altered glucose tolerance and an increased insulin level (19). Whether these alterations could be associated with an effect of amylin on cell birth will be assessed in this study.…”