Involvement of Hepatocyte Nuclear Factor 3 in Endoderm Differentiation of Embryonic Stem Cells

Abstract

The transcription factors of the hepatocyte nuclear factor 3 (HNF3) family, which are active in the liver, are expressed early during endoderm differentiation. To study their involvement in early murine development, we examined their role in embryonic stem (ES) cells. HNF3␣ or HNF3␤ mRNA transcripts were not detected in ES cells before differentiation, and only low levels of HNF3␤ mRNA were detected at a late stage of differentiation of ES cells to embryoid bodies (EB) (20 days after induction of differentiation). To examine the consequences of overexpressing HNF3␣ or -␤ in ES cells, we transfected the two genes into these cells and determined the levels of expression of tissue-specific genes during EB differentiation. Specifically, we examined expression of albumin, cystic fibrosis transmembrane conductance regulator (CFTR), phosphoenolpyruvate carboxykinase (PEPCK), ␣1-antitrypsin, transthyretin, -globin, and neurofilament 68kd as markers for different cell lineages. Overexpression of HNF3␤ (and to a lesser extent of HNF3␣) induced the expression of genes associated with endodermal lineage, namely, the genes for CFTR and albumin, but did not induce the expression of genes involved in late endoderm differentiation, such as the genes for PEPCK and ␣1-antitrypsin. Moreover, expression of HNF1␤ was highly induced in HNF3-overexpressing cells, while expression of HNF1␣ and HNF4 was only mildly induced in these cells. Therefore, HNF3␣ and -␤ seem to be involved in early endoderm differentiation of ES cells and together with other developmental factors are apparently needed for the induction of the endodermal lineage in vivo.The study of cell-specific transcriptional control has led to the identification of transcription factors which are enriched in hepatocytes, among them the hepatocyte nuclear factor 3 (HNF3) family (consisting of HNF3␣, -␤, and -␥) (42). The HNF3 proteins were first identified in rat liver nuclear extracts by virtue of their ability to bind specifically to sequences required for hepatocyte-specific expression of mouse genes (15). HNF3␤, -␣, and -␥ are sequentially activated during the development of the definitive endoderm (42). HNF3␤ mRNA is expressed in the node at the anterior end of the primitive streak in all three germ layers and is the first gene of this family to be activated (21). Subsequently, HNF3␣ is transcribed in the primitive endoderm in the region of the invaginating foregut, and HNF3␥ appears upon hindgut differentiation (21). HNF3␣ and -␤ are required for mesoderm and neural axis formation, as well as for liver-specific gene expression (21).Embryonic stem (ES) cells are clonal cells derived from the preimplantation mouse embryo (24). ES cells can multiply in culture and remain pluripotent. There are three main mechanisms by which ES cells can be induced to undergo differentiation to all cell types. First, when injected into the inner cell mass of a host blastocyst, they integrate into the inner cell mass and populate all cell lineages including the germ line. Second, when inject...

In Vitro Differentiation of Mouse Embryonic Stem Cells: Enrichment of Endodermal Cells in the Embryoid Body

“…Along with the previous success in generating ES-derived neurons [4,5] and pancreatic β cells [3,6,7], the next hurdle is to differentiate ES cells into fully functional hepatocyte for the treatment of chronic liver diseases. Expression of hepatocyte-related genes has been demonstrated in ES cells by RT-PCR [18][19][20][21], and markers for fully differentiated hepatic cells were identified in ES cells differentiated in dexamethasone and OSM containing culture medium [18]. Recently, several independent reports showed definite differentiation of hepatocytes from ES cells in vitro and in vivo [22][23][24][25][26][27]; however, basic mechanisms that underpin the differentiation of ES cells into endodermal cells and hepatocytes have not been elucidated.…”

In vitro directed differentiation of mouse embryonic stem cells into insulin-producing cells

“…The PCR products were separated using 2% agarose gels and stained with ethidium bromide. The oligonucleotide pairs used for PCR and the size of the amplified products were as follows: Nkx6.1 (55°C) TCTTCTGGCC-NGGGGTGATG (S) and CCTGCTTCTTCTTGGCGGTG (AS) (311 bp); Sur-1 (60°C) GATGCCATCATCACAGAAGG (S) and ATCACGAGGTCTGCACTCAG (AS) (236 bp); glucokinase (62°C) AGATCCTGGCAGAGTTCCAG (S) and CTTTCACCAGCATCACCCTG (AS) (219 bp); GLUT-2 (62°C) ACACCCCACTCATAGTCACAC (S) and CAGCAA-TGATGAGAGCATGTG (AS) (269 bp); insulin [12]; Pdx-1 and NeuroD [13]; ngn3 [14]; and β-actin [15]. All experiments were carried out in duplicate and the reproducibility of the observations was confirmed in three independent experiments.…”

Cloning of cDNA and the gene encoding human hepatocyte nuclear factor (HNF)-3β and mutation screening in Japanese subjects with maturity-onset diabetes of the young

“…The three structurally related proteins HNF-3a, HNF-3b, and HNF-3g, which are members of a family of winged helix transcription factors, are key regulators of endodermal cell lineage development [6]. Of these, HNF-3b has been shown to be involved in beta-cell-specific transcription of the IPF1 gene [7].…”