Isolation and Characterization of a Calcium Channel Gene, Cacna1f, the Murine Orthologue of the Gene for Incomplete X-Linked Congenital Stationary Night Blindness

Functional Characterization of the L-type Ca2+Channel Cav1.4α1 from Mouse Retina

“…The full-length cDNA of Ca v 1.4␣1 was determined to be 6111 bp with an open reading frame encoding a protein of 1984 amino acid residues (GenBank accession number of murine Ca v 1.4␣1: AJ579852; available by ftp at zippy.nimh.nih.gov/ or at http://rsb.info.nih.gov/nih-image; developed by Wayne Rasband, National Institutes of Health, Bethesda, MD). The sequence is nearly identical with the mouse sequence published by Naylor et al23 with the notable exception of a strongly diverging sequence stretch in the C terminus (amino acid residues 1768-1807). Inspection of the nucleotide sequences revealed that the profound differences in this stretch arise from frame shifts in the cDNA.…”

“…Sequences and Localization of PCR Primers Used for Cloning of Ca v 1.4␣1Coding sequences are represented in uppercase letters, 5Ј-and 3Ј-untranslated sequences are shown in lowercase letters.Molecular Cloning of Murine Ca v 1.4␣1To clone murine Ca v 1.4␣1 we designed specific primer pairs based on the previously published sequence of this channel(Table 1)23 and performed RT-PCR with retinal cDNA from mouse strain C57Bl6. The full-length cDNA of Ca v 1.4␣1 was determined to be 6111 bp with an open reading frame encoding a protein of 1984 amino acid residues (GenBank accession number of murine Ca v 1.4␣1: AJ579852; available by ftp at zippy.nimh.nih.gov/ or at http://rsb.info.nih.gov/nih-image; developed by Wayne Rasband, National Institutes of Health, Bethesda, MD).…”

The CaV1.4 Calcium Channel: More Than Meets the Eye

“…8,9 In situ hybridization revealed the presence of Ca v 1.4 transcript in the outer plexiform, outer nuclear, inner nuclear, and ganglion cell layers of the retina, 9 although the presence in the outer plexiform layer was not found in other studies. 10 Immunohistochemical experiments using different antibodies have shown multiple calcium channel subtypes expressed throughout the retina. [11][12][13][14] However, experiments designed to determine the localization of the Ca v 1.4 channel have led to varying results.…”

Up-regulation of L-type Voltage-dependent Calcium Channels after Long Term Exposure to Nicotine in Cerebral Cortical Neurons

“…Amplification of cDNA for ␣ 1F and ␤ 4 Subunits-cDNA for ␣ 1F and ␤ 4 subunits of L-type VDCCs was amplified from mouse brain cDNA by polymerase chain reaction using a set of oligonucleotides (␣ 1F , TTC-GACTCTTGTTGGGTCTTG and TCAAAGCGGGAAAGAATAGA; ␤ 4 , CTATAAACTCTCATCATTTCAC and TCATAACGGGTTGCACATAC) specific for the cDNA sequence of mouse ␣ 1F and ␤ 4 subunits of L-type VDCC (26,27). After the amplification, the cDNA was ligated with EcoRI adapter and inserted into the EcoRI site of pUC18.…”