Isolation and characterization of microsatellite loci from Quercus mongolica var. crispula

Abstract

Microsatellites were isolated and characterized for the Japanese oak species, Quercus mongolica var. crispula , distributed in temperate deciduous forests of Japan. Eleven of the 48 primer pairs designed successfully amplified unambiguous and polymorphic single loci among 67 Q. mongolica var. crispula individuals within a plot in southwestern Japan. The observed and expected heterozygosities of the 11 microsatellite markers ranged from 0.522 to 0.896 and from 0.536 to 0.882, respectively. These polymorphic microsatellite markers are useful for estimating pollen-mediated gene flow in Q. mongolica var. crispula .

The genetic structure of Quercus crispula in northeastern Japan as revealed by nuclear simple sequence repeat loci

“…Each extract was amplified by PCR, using a multiplex PCR Kit (QIAGEN) with seven nSSR primer pairs-QpZAG15, QpZAG36, QpZAG110 (Steinkellner et al 1997), MSQ13 (Dow et al 1995), bcqm31, bcqm42 and bcqm 325 (Mishima et al 2006)-in a single test tube. The 5.0 lL amplification reaction mixtures included 2.5 lL of MasterMix solution (QIAGEN), 1.3 lL of RNase-free water, 0.5 lL of primer mix solution (including the seven pairs of primers, each at 0.5 pmol/lL), and 0.7 lL of the extracted DNA (1-20 lg/mL).…”

Genetic diversity and differentiation of Quercus semiserrata Roxb. in northern Thailand revealed by nuclear and chloroplast microsatellite markers

“…), ssrQpZag9 and ssrQpZag46 developed for Q. petraea (Steinkellner et al, 1997), quru-GA-1C08 and quru-GA-0C19 developed for Q. rubra (Preston et al, 2002), and bcqm07 and bcqm96 developed for Q. magnolica var. crispula (Mishima et al, 2006). The sequences of forward and reverse primers for the locus CA15 were CGGTAAGACGTTTGGTGTAG and TTGTACGGACGCCATTGAAA, respectively.…”

Gene flow pattern and mating system in a small population of Quercus semiserrata Roxb. (Fagaceae)

“…crispula (Mishima et al, 2006). The sequences of forward and reverse primers for the locus CA15 were CGGTAAGACGTTTGGTGTAG and TTGTACGGACGCCATTGAAA, respectively.…”