Isolation and characterization of novel goose parvovirus-related virus reveal the evolution of waterfowl parvovirus

Abstract

Short beak and dwarfism syndrome (SBDS) has been constantly breaking out in China since 2015. It is caused by a novel goose parvovirus-related virus (NGPV) and can severely restrict the growth of ducks. In this study, seven NGPV stains were isolated from different regions in China between 2015 and 2016. To better understand the correlation between NGPV and goose parvovirus (GPV), we conducted complete genome sequencing and a comprehensive analysis of the NGPV genome. The phylogenetic and alignment analysis showed that NGPV is a branch of GPV, sharing 92.2%-97.1% nucleotide identity with GPV. Compared with classical GPV, five consensus nucleotide mutations in all the seven NGPV isolates and two 14-nucleotide-pair deletions in six NGPV isolates were found in the inverted terminal repeats, twelve and eight synchronous amino acid changes were found in the replication protein and capsid protein of NGPV, respectively, which might be important for viral gene regulation, humoral immune responses, and host transfer. Notably, SDLY1602 was demonstrated a recombinant strain, with the potential major parent GPV vaccine strain 82-0321v and the minor parent GPV wild strain GDaGPV. This is the first report showing that the recombination between two classical GPV strains generated a NGPV strain circulating in nature. This study will advance our understanding of NGPV molecular biology and facilitate to elucidate the evolutionary characteristics of GPV.

Duck “beak atrophy and dwarfism syndrome” disease complex: Interplay of novel goose parvovirus-related virus and duck circovirus?

“…The primers were as follows: NGPV‐1F (5′‐AGA CTT ATC AACAAC CAT (C)T‐3′, position 3278–3296) and NGPV‐1R (5′‐TCA CTT ATT CCT GCT GTA G‐3′, position 4038–4056) were designed to amplify a 779‐base pair (bp) fragment, NGPV‐2R (5′‐CAT CAT CCG TAA AAA CTT GG‐3′, position 3406–3425) was designed with NGPV‐1F to amplify a 147 bp fragment. The seminested PCR assay was performed as our previous work (Li, Lin et al., ; Li, Zhang et al., ).…”

Whole Genome Characterization and Genetic Evolution Analysis of a New Ostrich Parvovirus

“…The primers were designed as described by Li et al [7] to amplify the complete genomes of the OsPV strains. The genomes were amplified using PrimeStar HS DNA polymerase (TaKaRa, Beijng, China).…”

Novel goose parvovirus in domestic Linwu sheldrakes with short beak and dwarfism syndrome, China

“…These five viruses were prepared for PCR using Viral DNA Kit (Omega Bio‐Tek). All samples were subjected to PCR using specific primers (P4‐F: 5′‐ CTTGATGATGCTGAAAATGAAC‐3′ and P4‐R: 5′‐ GCCCATGGTGCCATAAGC‐3′) to amplify a partial sequence (1,446 bp) of the N‐GPV, described previously (Li et al, ). The target amplified PCR products were purified (Gel Extraction Kit; Omega Bio‐Tek), T‐A cloned (pBackZero8‐T vector cloning kit; Takara) and then sequenced in both directions (Sangon Biotech) using an ABI 3730 DNA sequencer (ABI).…”

“…The complete genome of HuN18 strain was amplified using PCR with the primers described previously (Li et al, ). The target amplified PCR products were purified, T‐A cloned and then sequenced in both directions.…”

“…The phylogenetic and alignment analysis showed that N‐GPV is a branch of GPV, sharing more than 92.2% nucleotide similarity at the genome level. Although the mortality rate was less than 3.0% in affected flocks, with a morbidity rate of less than 30%, ducks with SBDS showed growth retardation with beak atrophy, which caused large losses in the duck industries (Bian et al, ; Chen et al, , ; Li et al, ; Ning et al, ).…”