Isolation and molecular characterization of a novel <i>pseudomonas putida</i> strain capable of degrading organophosphate and aromatic compounds

Abstract

A bacterial strain designated in this study as POXN01 was found to be capable of degrading the synthetic organophosphorus pesticides paraoxon and methyl parathion. The strain was initially isolated through enrichment technique from rice field soil near Harlingen, Texas. Phylogenetic analysis based on 16S rRNA, gyrB and rpoD gene alignments identified the POXN01 isolate as a new strain of Pseudomonas putida, which is closely related to the recently discovered nicotine-degrading strain Pseudomonas putida S16. While being unable to metabolize nicotine, the POXN01 isolate was observed to actively proliferate using monocyclic aromatic hydrocarbons, in particular toluene, as nutrients. Search for the genetic determinants of paraoxon catabolism revealed the presence of organophosphorus-degrading gene, opd, identical to the one from Sphingobium fuliginis (former Flavobacterium sp. ATCC 27551). Assimilation of aromatic compounds likely relies on phc ARKLMNOPQ gene cluster for phenol, benzene and toluene catabolism, and on benRABCDKGEF cluster for benzoate catabolism. The observed versatility of POXN01 strain in degradation of xenobiotics makes it useful for the multi-purpose bioremediation of contaminated sites in both agricultural and industrial environmental settings.

Specific Gene Loci of Clinical Pseudomonas putida Isolates

“…It should be noted that P . putida POXN01, other strain isolated from rice fields [ 52 ] as S16, has high relationship with strains clade I ( S1 Fig ). HB4184 and H8234 were found to be placed within a different clade, together with the fresh water isolate GB-1; protein identities of these strains were at least >80%.…”

Biodegradation of Endosulfan as an Organochlorine Pesticide with Pseudomonas plecoglocissida Transfected by LinA Gene

“…These results showed that with increasing incubation time, concentration of the remaining of endosulfan pesticide decreased in culture tubes (Table 1). Organochlorine pesticides are utilized directly for agricultural farms or soil and can contaminate sewerage and ditches, which in turn may be transported to rivers, and when this substances are distributed in the environment they become a pollutant and require remediation (12)(13)(14).…”

“…Media for bacterial growth: carbon-deficient minimal medium (CSM) and Luria-Bertani Medium (LB) were prepared as described previously (OD 600 nm) (12). Immediately before inoculation, CSM was supplemented with different concentration (100, 200, 300, and 400 µg/ML) of endosulfan.…”

Biodegradation of Paraoxan as an Organophosphate Pesticide with Pseudomonas plecoglocissida Transfected by opd Gene

“…Degradation of organophosphate by resting cells: Degradation experiment of OP was performed as previously described by Lyer et al (23). Briefly, 150 mL of LB medium was inoculated with transfected P. plecoglossicida on a rotary shaker at 37°C with 200 rpm rotation until cell density reached 1.0 at OD = 600.…”

“…ATCC 27551; forward primer: CGCCACTTTCGATGCGAT; reverse primer: CTTCTAGACCAATCGCACTG (23). PCR program was as follows: 4.5 minutes at 94°C, 32 cycles at 94°C for 30 seconds, 55°C for 30seconds and 72°C for1 minute with a final elongation step at 72°C for 4 minutes.…”