Isolation of a cDNA Representing the Fanconi Anemia Complementation Group E Gene

Winter, Johan P. de; Berkel, Carola G.M. van; Rooimans, Martin A.; Weel, Laura van der; Steltenpool, Jûrgen; Demuth, Ilja; Morgan, Neil V.; Alon, Noa; Bosnoyan-Collins, Lucine; Lightfoot, Jeff; Leegwater, P.A.J.; Waisfisz, Quinten; Komatsu, Kenshi; Arwert, Fré; Pronk, Jan C.; Mathew, Christopher; Digweed, Martin; Buchwald, Manuel; Joenje, Hans

doi:10.1016/s0002-9297(07)62959-0

Cited by 198 publications

(60 citation statements)

References 16 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The FANCA multiplex quantitative fluorescent PCR (QF-PCR) gene dosage assay used has been previously described by Morgan et al 28 This multiplex amplifies five exons (5,11,17,21, and 31) and uses exon 1 of the myelin protein zero (MPZ) gene as a non-FA gene control. An additional biplex assay that amplifies a 352 bp fragment encompassing both exons 19 and 20 of FANCA and exon 1 of MPZ was also designed (forward 5 0 GAAACACCGGTCACCGTCTGTG 3 0 , reverse 5 0 AGATCCAC-GATTCTTCGCATTGTC 3 0 ).…”

Section: Quantitative Fluorescent Pcr Analysis Of Fanca Gene Dosagementioning

confidence: 99%

“…3 A recent survey of cancer incidence in 145 FA patients reported nine cases of myeloid leukemia with a median age-of-onset of 11.3 years, and a ratio of observed to expected cases of 785. 4 Complementation analysis by cell fusion and correction of crosslinker hypersensitivity has delineated at least eight complementation groups; FA-A, B, C, D1, D2, E, F, G, 5 six genes have been cloned, FANCA, C, D2, E, F, G, [6][7][8][9][10][11][12] and a recent report has shown biallelic inactivation of BRCA2 in FA-D1 cell lines. 13 Since the incidence of AML is highly elevated in FA patients, it is possible that inherited or acquired mutations in the FA genes contribute to the etiology of sporadic AML.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Deletion and reduced expression of the Fanconi anemia FANCA gene in sporadic acute myeloid leukemia

et al. 2004

View full text Add to dashboard Cite

Fanconi anemia (FA) is an autosomal recessive chromosomal instability disorder caused by mutations in one of seven known genes (FANCA,C,D2,E,F,G and BRCA2). Mutations in the FANCA gene are the most prevalent, accounting for two-thirds of FA cases. Affected individuals have greatly increased risks of acute myeloid leukemia (AML). This raises the question as to whether inherited or acquired mutations in FA genes might be involved in the development of sporadic AML. Quantitative fluorescent PCR was used to screen archival DNA from sporadic AML cases for FANCA deletions, which account for 40% of FANCA mutations in FA homozygotes. Four heterozygous deletions were found in 101 samples screened, which is 35-fold higher than the expected population frequency for germline FANCA deletions (Po0.0001). Sequencing FANCA in the AML samples with FANCA deletions did not detect mutations in the second allele and there was no evidence of epigenetic silencing by hypermethylation. However, real-time quantitative PCR analysis in these samples showed reduced expression of FANCA compared to nondeleted AML samples and to controls. These findings suggest that gene deletions and reduced expression of FANCA may be involved in the promotion of genetic instability in a subset of cases of sporadic AML.

show abstract

Section: Quantitative Fluorescent Pcr Analysis Of Fanca Gene Dosagementioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Deletion and reduced expression of the Fanconi anemia FANCA gene in sporadic acute myeloid leukemia

et al. 2004

View full text Add to dashboard Cite

show abstract

“…To date, 7 FA genes have been cloned, and the sequences of the representative cDNAs for the FANCA, 22,23 FANCC, 24 FANCD2, 25 FANCE, 26 FANCF, 27 FANCG, 28 and FANCD1 (BRCA2) 29 genes are available. QRT-PCR was used to quantify transcripts from each of these genes relative to an internal amplification standard (18S RNA) and also compared with the myeloid cell line Mo7e ( Figure 3).…”

Section: Fa Gene Transcripts Are Quantitatively Normalmentioning

confidence: 99%

“…Seven of the FA genes have been cloned. [22][23][24][25][26][27][28][29] Apart from BRCA2 (the FANCD1 gene), the cloned sequences bear homologies neither to other known genes nor to one another. The FA genes clearly protect cells from genotoxic stress.…”

Section: Genetic Analysis Of a Lymphoblastoid Cell Line From The Samementioning

confidence: 99%

Acquired FANCA dysfunction and cytogenetic instability in adult acute myelogenous leukemia

Lensch¹

2003

Blood

View full text Add to dashboard Cite

Myelodysplastic and leukemic stem cell clones that evolve in children and adults with Fanconi anemia universally bear complex cytogenetic abnormalities. The abnormalities are generally recurring deletions or chromosomal loss and involve precisely the same chromosomes with the same frequency as has been described in marrow cells from patients with secondary acute leukemia induced by alkylating agents. Reasoning that acquired Fanconi anemia protein dysfunction might contribute to cytogenetic instability in secondary acute myelogenous leukemia (AML) cells, we analyzed leukemic cells bearing characteristic complex cytogenetic defects obtained from a 68-year-old man whose lymphoblasts showed no evidence of Fanconi anemia. Unlike the lymphoblasts, this myeloid leukemia cell line (UoC-M1) was hypersensitive to mitomycin-C (MMC) and diepoxybutane (DEB) and exhibited a marked decrease in nuclear FANCA, FANCG, and FANCD2-L. Retroviral transduction of FANCA significantly reduced MMC sensitivity but FANCF, FANCG, and FANCC did not. Overexpression of FANCA restored levels of both FANCA and FANCG, whereas overexpression of FANCG or IntroductionA variety of molecular defects have been discovered in patients with myeloproliferative syndromes and acute myelogenous leukemia, many of which result in the activation of autonomous signal transduction pathways for growth and survival. [1][2][3][4][5] Although oncogenic mutations in such pathways are sufficient to induce myeloproliferative disorders in transgenic mice, 2,3 the development of acute leukemia requires additional mutations that ultimately interfere with myeloid differentiation. 6 The risk of this second type of mutation would be necessarily enhanced by cytogenetic instability, a manifestation of which in the leukemic clone would be multiple cytogenetic defects. That such complex cytogenetic defects universally occur in the myeloid leukemic clones of children with Fanconi anemia, a cytogenetic instability syndrome, supports this notion. In fact, because the clonal abnormalities found in this clinical context exactly recapitulate those found in patients with secondary myelodysplastic syndrome (MDS) and acute myelogenous leukemia (AML), 7,8 and high-risk MDS, 9 we hypothesized that acquired Fanconi anemia (FA) protein dysfunction might serve as a progression factor for the evolution of cytogenetically unstable AML clones, even in patients without hereditary evidence of Fanconi anemia. To test this notion, we examined a variety of AML cells and cell lines, including a cell line from a 68-year-old patient with cytogenetic defects characteristic of secondary AML. The patient's lymphoblasts were normal, but the leukemic cell population exhibited hypersensitivity to mitomycin C, a feature of Fanconi anemia. Nuclear FANCC, FANCG, and FANCA levels were markedly reduced, and retroviral complementation indicated that the leukemic cells exhibited a secondary defect of FANCA function. Because lymphoblasts from this same patient showed normal levels of nuclear Fanconi proteins, we propo...

show abstract

“…Patients may also have congenital malformations including short stature, small gonads, microphthalmia, and skeletal defects (Alter 1993). At least eight complementation groups exist (FA-A through FA-G, including D1 and D2; Joenje et al 1997;Timmers et al 2001), and the genes for seven of these have been identified (FANCA, FANCC, FANCD2, FANCE, FANCF, FANCG, and BRCA2;Strathdee et al 1992;Lo Ten Foe et al 1996;de Winter et al 1998de Winter et al , 2000aTimmers et al 2001;Howlett et al 2002).…”

mentioning

confidence: 99%

Epithelial cancer in Fanconi anemia complementation group D2 (Fancd2) knockout mice

Houghtaling¹,

Timmers²,

Noll³

et al. 2003

Genes Dev.

272

298

View full text Add to dashboard Cite

Fanconi anemia (FA) is a genetic disorder characterized by hypersensitivity to DNA damage, bone marrow failure, congenital defects, and cancer. To further investigate the in vivo function of the FA pathway, mice with a targeted deletion in the distally acting FA gene Fancd2 were created. Similar to human FA patients and other FA mouse models, Fancd2 mutant mice exhibited cellular sensitivity to DNA interstrand cross-links and germ cell loss. In addition, chromosome mispairing was seen in male meiosis. However, Fancd2 mutant mice also displayed phenotypes not observed in other mice with disruptions of proximal FA genes. These include microphthalmia, perinatal lethality, and epithelial cancers, similar to mice with Brca2/Fancd1 hypomorphic mutations. These additional phenotypes were not caused by defects in the ATM-mediated S-phase checkpoint, which was intact in primary Fancd2 mutant fibroblasts. The phenotypic overlap between Fancd2-null and Brca2/Fancd1 hypomorphic mice is consistent with a common function for both proteins in the same pathway, regulating genomic stability.[Keywords: Fanconi anemia; cancer; Fancd2; Brca2; DNA repair; chromosome pairing] Supplemental material is available at http://www.genesdev.org.

show abstract

Isolation of a cDNA Representing the Fanconi Anemia Complementation Group E Gene

Cited by 198 publications

References 16 publications

Deletion and reduced expression of the Fanconi anemia FANCA gene in sporadic acute myeloid leukemia

Deletion and reduced expression of the Fanconi anemia FANCA gene in sporadic acute myeloid leukemia

Acquired FANCA dysfunction and cytogenetic instability in adult acute myelogenous leukemia

Epithelial cancer in Fanconi anemia complementation group D2 (Fancd2) knockout mice

Contact Info

Product

Resources

About