Isolation of an Avian Serovar of<i>Chlamydia Psittaci</i>from a Case of Bovine Abortion

Cox, Hollis Utah; Hoyt, Phillip G.; Poston, Robert P.; Snider, T.G.; Lemarchand, Thomas; O’Reilly, Kathy L.

doi:10.1177/104063879801000310

Cited by 19 publications

(12 citation statements)

References 6 publications

(5 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…It was less likely that the abortion cases studied herein were transmitted from birds, because only 76-85% homology and a distinguishable RFLP pattern were found with C. psittaci avian strains (Figs. 1, 2), although an avian serovar strain of C. psittaci had been isolated from bovine abortion cases [2]. It seems unnecessary to prevent the contact between birds and ruminants for disease control.…”

Section: Discussionmentioning

confidence: 99%

Prevalence of Chlamydophila abortus Infection in Domesticated Ruminants in Taiwan.

Wang

Shieh

Liao

2001

The Journal of Veterinary Medical Science

View full text Add to dashboard Cite

ABSTRACT. This study is to (1) investigate the prevalence of Chlamydophila abortus infection in cows and goats in Taiwan, and (2) compare the genetic properties of Taiwanese isolates with abortion strains from other sources. Approximately 71% of aborted cows and 58% of aborted does had IgG against C. abortus in their sera. The seroprevalence rate in cows may be overestimated, because a certain degree of cross-reactivity with C. pecorum cannot be ruled out. Only 22.7% (from aborted cows) and 33.3% (from aborted does) of vaginal swabs that tested positive by polymerase chain reaction led to successful isolation of C. abortus by inoculation into chicken embryos, equivalent to 7.1% and 7.9% of isolation rates, respectively. The major outer membrane protein gene of 15 Taiwanese abortion isolates was compared with that of various strains by restriction fragment length polymorphism (RFLP) and nucleotide sequencing. Restriction enzyme CfoI was able to distinguish Taiwanese ruminant isolates, which have identical RFLP patterns, from C. felis (feline) and C. psittaci (avian) strains. Taiwanese isolates had 98.8-100% homology with known ruminant abortion strains and were phylogenetically closest to bovine LW508 strain. KEY WORDS: bovine, caprine, Chlamydophila abortus infection, major outer membrane protein gene, RFLP.

show abstract

Section: Discussionmentioning

confidence: 99%

Prevalence of Chlamydophila abortus Infection in Domesticated Ruminants in Taiwan.

Wang

Shieh

Liao

2001

The Journal of Veterinary Medical Science

View full text Add to dashboard Cite

show abstract

“…Certain avian C. psittaci strains have been reported to show similarity to ovine abortion-inducing strains in restriction enzyme analysis (6) and in the omp1 sequence (20); likewise, an avian serovar B was reported from a case of bovine abortion (2). However, the risk of laboratory contamination between avian and abortion-inducing C. psittaci strains has been suggested as a possible explanation for the exceptional cases of similarity between strains of different host origins (9,18).…”

mentioning

confidence: 91%

Chlamydophila abortus in a Brown Skua ( Catharacta antarctica lonnbergi ) from a Subantarctic Island

Herrmann¹,

Rahman²,

Bergström³

et al. 2000

Appl Environ Microbiol

View full text Add to dashboard Cite

On Bird Island, South Georgia, a new strain of Chlamydophila abortus was detected in one Brown skua out of 37 specimens from six different seabird species. Phylogenetic analysis of the rnpB and omp1 genes indicated the strain to be more closely related to C. abortus than to 6BC, the type strain of Chlamydophila psittaci.The family Chlamydiaceae was recently reclassified and now comprises nine separate species (5) that infect a wide variety of animals. Chlamydophila psittaci (previously Chlamydia psittaci) has been detected in at least 130 bird species (1,14,19).In this study we detected Chlamydophila abortus (previously a member of the Chlamydia psittaci group) in a Brown skua (Catharacta antarctica lonnbergi) on Bird Island (54°1ЈS, 58°3ЈW), South Georgian archipelago. The avifauna is abundant, with 24 breeding species of seabirds (17). Shedding organisms from the respiratory tract were obtained by fecal swabs (22) from 37 birds of six different species of subantarctic seabirds. Transportation from Bird Island occurred irregularly; swabs were therefore stored for 3 weeks at Ϫ20°C in 0.2 M sucrose-phosphate-buffered saline before being transported to the laboratory. Since culture of C. psittaci requires a biosafety lab of class 3, isolation was not attempted.DNA was extracted from feces by using a QIAamp tissue kit (Qiagen, Hilden, Germany), and the rnpB and omp1 genes were amplified by PCR. The rnpB gene encodes the catalytically active RNA subunit of RNase P and is present in all prokaryotic cells and therefore useful for taxonomic analysis (10). For PCR amplification and subsequent sequencing of the Chlamydophila sp. obtained from specimen R54 (designated strain R54) from a Brown skua, the primer pair JB1 and JB2 was used (10).The chlamydial outer membrane protein encoded by omp1 shows variation between species and strains (8, 11), and the gene was used for characterization of strain R54. For amplification of a 1,032-bp gene segment, a seminested PCR method was used according to the work of Kaltenboeck et al. (12) with minor modifications. The primers in the first step were 9CTROMP (5ЈGCTCTGCCTGTGGGGAATCCTGCTGAA CC3Ј) and CHOMP371 [5ЈTTAGAAIC(GT)GAATTGIGC (AG)TTIA(TC)GTGIGCIGC3Ј], and in the second step the upstream primer was replaced by 29CTROMP (5ЈGGAGAT CCTTGCGATCCTTG3Ј). The resulting PCR products were sequenced by using terminator-labeled cycle sequencing chemistry and sequence primers, including 29CTROMP, 191CHOMP (5ЈGCIYTITGGGARTGYGGITGYGCIAC3Ј), CTR215 [5ЈTCTTCGA(C/T)TTT(A/T)GGTTTAGATTGA3Ј], and CHOMP371. Sequence reactions were analyzed on a 310 Genetic Analyzer (PE Biosystems, Norwalk, Conn.).Sequence alignment was based on a previous analysis (10) and use of the CLUSTAL W multiple alignment program (21). Phylogenetic analysis of the calculated distance matrix was done by using the neighbor-joining program, as previously described (10), and the obtained tree was displayed by using TREEVIEW (15).In 37 samples from seabirds, one case of chlamydial infection (R54) was detected. The rnpB nucleotide seq...

show abstract

“…Another possibility is that the nervous system lesions of SBE and BIV are closely similar or identical at the light microscopic level [34]. Months after completion of this investigation, a cow aborted with a pigeon strain of C. psittaci which was isolated from the placenta and fetus [35]. Several weeks later this cow (which was serologically positive for BIV) died with metritis and brain lesions of non-suppurative lymphocytic encephalitis.…”

Section: Discussionmentioning

confidence: 99%

Natural bovine lentiviral type 1 infection in Holstein dairy cattle. I. Clinical, serological, and pathological observations

Snider

Hoyt

Coats

et al. 2003

Comparative Immunology, Microbiology and Infectious Diseases

View full text Add to dashboard Cite

Clinical, serological, and pathological abnormalities observed in Holstein cows naturally infected with bovine lentivirus 1 bovine immunodeficiency virus (BIV) and other infections were progressive and most commonly associated with weight loss, lymphoid system deficiency, and behavioral changes. Clinical evidence of meningoencephalitis was dullness, stupor, and occasional head or nose pressing postures. The polymerase chain reactions associated the BIV provirus with the lesions in the central nervous system and lymphoid tissues. Multiple concurrent infections developed in retrovirally infected cows undergoing normal stresses associated with parturition and lactation. A major functional correlate of the lymphoreticular alterations was the development of multiple secondary infections which failed to resolve after appropriate antibacterial therapy. The chronic disease syndrome in dairy cows associated with BIV may be useful as a model system for investigation of the pathogenesis of the nervous system lesions and lymphoid organ changes that occur in humans with lentiviral infection.

show abstract

Isolation of an Avian Serovar ofChlamydia Psittacifrom a Case of Bovine Abortion

Cited by 19 publications

References 6 publications

Prevalence of Chlamydophila abortus Infection in Domesticated Ruminants in Taiwan.

Prevalence of Chlamydophila abortus Infection in Domesticated Ruminants in Taiwan.

Chlamydophila abortus in a Brown Skua ( Catharacta antarctica lonnbergi ) from a Subantarctic Island

Natural bovine lentiviral type 1 infection in Holstein dairy cattle. I. Clinical, serological, and pathological observations

Contact Info

Product

Resources

About