Isolation of bacteriocinogenic strain of Lactococcus lactis subsp. lactis from rocket salad (Eruca sativa Mill.) and evidences of production of a variant of nisin with modification in the leader-peptide

Kruger, Monika Francisca; Barbosa, Matheus de Souza; Miranda, Antônio; Landgraf, Mariza; Destro, Maria Teresa; Todorov, Svetoslav Dimitrov; Franco, Bernadette Dora Gombossy de Melo

doi:10.1016/j.foodcont.2013.03.043

Cited by 35 publications

(19 citation statements)

References 48 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…This corresponds to early, middle and late exponential phase, respectively. Such a variability in the start of bacteriocin production was already observed among different strains of L. lactis or in media with different composition (Kruger et al ., ). The highest bacteriocin activity was 51 200 AU mL −1 , for all variants, recorded after 9–12 h of growth, corresponding to early stationary phase, suggesting that the bacteriocin is a secondary metabolite (Ponce et al ., ; Tafreshi et al ., ).…”

Section: Resultsmentioning

confidence: 97%

Production, mode of action and sequencing of the corresponding gene of a bacteriocin produced by Lactococcus lactis 19.3

Zamfir

Stefan

Stancu

et al. 2016

Int J of Food Sci Tech

View full text Add to dashboard Cite

Summary Lactococcus lactis 19.3 produces a bacteriocin with a wide inhibitory spectrum, including the food pathogen Listeria monocytogenes. The producing strain was able to grow and produce similar amounts of bacteriocin in MRS medium, cow's milk and soya milk, respectively. The mode of action of this bacteriocin was further investigated using two indicator strains, Lactobacillus delbrueckii subsp. bulgaricus LMG 6901T and Listeria monocytogenes ATCC 1911‐1. The bacteriocin displayed a bactericidal effect, causing a rapid decrease of the cell viability. Bacteriocin treatment of the sensitive strains resulted in major morphological changes, including pore formation, as shown by scanning electron microscopy. Finally, the bacteriocin‐encoding gene was identified by sequencing. The presence of nisin gene was confirmed. Based on all our data gathered so far, L. lactis 19.3 is a good candidate for a starter or protective culture in the manufacturing of both fermented dairy and vegetarian food products.

show abstract

Section: Resultsmentioning

confidence: 97%

Production, mode of action and sequencing of the corresponding gene of a bacteriocin produced by Lactococcus lactis 19.3

Zamfir

Stefan

Stancu

et al. 2016

Int J of Food Sci Tech

View full text Add to dashboard Cite

show abstract

“…When tested for adsorption to the L. monocytogenes Scott A cells, the bacteriocin was 100% adsorbed after 1 h at 37 C. The mode of action of bacteriocin produced by Lb. plantarum MBSa4 against L. monocytogenes, when added in the MIC amount (160 AU/ml), was bacteriostatic (Kruger et al, 2013). It is known that the electrostatic interactions with cytoplasmic membranes of bacteria are responsible for the initial binding of class II bacteriocins (Drider, Fimland, H echard, McMullen, & Pr evost, 2006).…”

Section: Resultsmentioning

confidence: 99%

“…plantarum MBSa4 was determined according to Todorov, Wachsman, et al (2010). A 24 h culture of L. monocytogenes Scott A (10 5 e10 6 CFU/ml) grown on BHI was transferred to fresh BHI and bacteriocin MBSa4 (160 AU/ml final concentration) was added to the culture at times 0 h and 6 h of incubation at 37 C. L. monocytogenes growth was monitored by spectrophotometric measurements (Thermo Fisher Scientific Multiskan ® FC, Germany) at 595 nm for 24 h, every 2 h. A culture of L. monocytogenes Scott A without addition of bacteriocin was used as control (Kruger et al, 2013).…”

Section: Mode Of Actionmentioning

confidence: 99%

Characterization of a two-peptide plantaricin produced by Lactobacillus plantarum MBSa4 isolated from Brazilian salami

et al. 2016

View full text Add to dashboard Cite

a b s t r a c tThe aim of this study was to explore the biochemical and genetic features of the two-peptide bacteriocin produced by a Lactobacillus plantarum strain isolated from Italian type salami produced in Brazil (Lb. plantarum MBSa4). Identification of bacteriocinogenic Lb. plantarum MBSa4 was performed by 16S rRNA sequencing. Expressed bacteriocin was evaluated for spectrum of activity, heat and pH stability, mechanism of action, and molecular mass. Partial purification was achieved by cation-exchange, and reversed phase -HPLC. Total DNA of Lb. plantarum MBSa4 was extracted and tested for presence of previously described bacteriocin genes. Bacteriocin MBSa4 was heat-stable, unaffected by pH 2.0 to 6.0 and active against all tested Listeria monocytogenes strains and most of tested fungi. Maximal production (1600 AU/ ml) in MRS broth occurred after 22 h at 25 C, presenting bacteriostatic activity as result of combined action of two components. The molecular mass determined by SDS-PAGE was 2.3 kDa. PCR-amplified DNA indicated the same nucleotide sequence of plantaricin W. Results indicate that Lb. plantarum MBSa4 produces plantaricin W, a two-peptide lantibiotic with remarkable anti-Listeria activity.

show abstract

“…The following primer pairs were used: nis for nisin Z (203 bp, nisAF: 5′‐ATG AGTACA AAAGATTTCAACTT‐3′; nisAR: 5′‐TTATTTGCTTACGTGAACGC‐3′ (Kruger et al . )); Bli04127 for lichenicidin (215 bp, F: 5′‐GGAAATGATTCTTTCATGG‐3′, R: 5′‐TTAGTTACAGCTTGGCATG‐3′ (Prieto et al . )) and SubA for subtilomycin (968 bp, subA2569‐F: 5′‐TGCGGATGACAGATTCGTATTGC‐3′, subA2571‐R: 5′‐ACAGCTGTACCGTGCCCATATAGA‐3′ (Phelan et al .…”

Section: Methodsmentioning

confidence: 99%

Inhibition ofListeria monocytogenesbiofilms by bacteriocin-producing bacteria isolated from mushroom substrate

et al. 2016

View full text Add to dashboard Cite

show abstract

Isolation of bacteriocinogenic strain of Lactococcus lactis subsp. lactis from rocket salad (Eruca sativa Mill.) and evidences of production of a variant of nisin with modification in the leader-peptide

Cited by 35 publications

References 48 publications

Production, mode of action and sequencing of the corresponding gene of a bacteriocin produced by Lactococcus lactis 19.3

Production, mode of action and sequencing of the corresponding gene of a bacteriocin produced by Lactococcus lactis 19.3

Characterization of a two-peptide plantaricin produced by Lactobacillus plantarum MBSa4 isolated from Brazilian salami

Inhibition ofListeria monocytogenesbiofilms by bacteriocin-producing bacteria isolated from mushroom substrate

Contact Info

Product

Resources

About