Isolation of betanodavirus from farmed turbot Psetta maxima showing no signs of viral encephalopathy and retinopathy

Journal of General Virology

Mérour

Biacchesi

et al. 2015

We previously reported that betanodavirus reassortant strains [redspotted grouper nervous necrosis virus/striped jack nervous necrosis virus (SJNNV)] isolated from Senegalese sole (Solea senegalensis) exhibited a modified SJNNV capsid amino acid sequence, with changes at aa 247 and 270. In the current study, we investigated the possible role of both residues as putative virulence determinants. Three recombinant viruses harbouring site-specific mutations in the capsid protein sequence, rSs160.03 247 (S247A), rSs160.03 270 (S270N) and rSs160.03 247+270 (S247A/S270N), were generated using a reverse genetics system. These recombinant viruses were studied in cell culture and in vivo in the natural fish host. The three mutant viruses were shown to be infectious and able to replicate in E-11 cells, reaching final titres similar to the WT virus, although with a somewhat slower kinetics of replication. When the effect of the amino acid substitutions on virus pathogenicity was evaluated in Senegalese sole, typical clinical signs of betanodavirus infection were observed in all groups. However, fish mortality induced by all three mutant viruses was clearly affected. Roughly 40 % of the fish survived in these three groups in contrast with the WT virus which killed 100 % of the fish. These data demonstrated that aa 247 and 270 play a major role in betanodavirus virulence although when both mutated aa 247 and 270 are present, corresponding recombinant virus was not further attenuated.

mentioning

confidence: 99%

In vitro and in vivo characterization of molecular determinants of virulence in reassortant betanodavirus

Journal of General Virology

Mérour

Biacchesi

et al. 2015

“…However, a RGNNV‐type strain did not cause mortality in turbot at 18 °C (Olveira et al . ). In addition, whereas the RGNNV‐type strains typically provoke infections in sea bass and grouper between 23 and 30 °C (Maltese & Bovo ), the reassortants can cause high mortalities in sole between 18 and 22 °C (Souto et al .…”

Section: Discussionmentioning

confidence: 97%

“…More recently, an isolate belonging to the RGNNV genotype has been obtained from juvenile farmed turbot with no signs of VER (Olveira et al . ).…”

Section: Introductionmentioning

confidence: 97%

Reassortant betanodavirus infection in turbot (Scophthalmus maximus)

Journal of Fish Diseases

Olveira

Dopazo

et al. 2016

In this study, the susceptibility of turbot juveniles to two betanodavirus strains was assessed, a RGNNV/SJNNV reassortant (Ss160.03) and a SJNNV strain. The reassortant isolate exhibits a slightly modified SJNNV CP, with two amino acid substitutions in the C-terminal domain (positions 247 and 270). To analyse the role of these residues as virulence and host determinants in turbot, three recombinant strains (rSs160.03 , rSs160.03 , rSs160.03 ) harbouring site-specific mutations in the CP sequence were also tested in experimental trials. Moderate mortalities (up to 50%) were recorded at 18 °C in the fish challenged with the Ss160.03 strain, whereas low mortalities (17%) were observed in the group challenged with the SJNNV strain. A slight decrease (around 10%) was observed in the mortalities caused by the mutants rSs160.03 and rSs160.03 , whilst the mutation of both positions reduced mortality by more than half of that observed in fish challenged with the wild strain. These results are confirmed by the replication in brain tissues, because whereas the wild strain was detected from 5 to 30 dpi and reached the highest viral load, the recombinant virus harbouring both mutations was not detected in the brain until 20 dpi and with a moderate viral load.

“…A total of 140 Senegalese sole (mean weight 1.5 g) were used in the challenge experiment, and 10 fish were used for pathologic examination of bacterial pathogens and the viral agents infectious pancreatic necrosis virus (IPNV), infectious haematopoietic necrosis virus (IHNV), viral haemorrhagic septicaemia virus (VHSV) and betanodavirus as described by Olveira, Souto, Dopazo, and Bandín (). The fish were maintained in the fish facilities of the Universidade de Santiago de Compostela, in opaque plastic tanks containing sea water at a temperature of approximately 22°C.…”

Section: Methodsmentioning

confidence: 99%

“…Extracted RNA was reverse‐transcribed using SuperScript IV Reverse Transcriptase (Invitrogen) and random primers. For quantitative real‐time PCR (qPCR), reactions were processed with 2 μl of cDNA samples in 20 μl final volume using iQ ™ SYBR ® Green Supermix (Bio‐Rad), and 200 nM of the specific primers SnodR1 F/R (Olveira et al., ) for RNA1. For RNA2, the primers T_SJCoat_F/R GGATTTCGTTCCATTCTCTTGGG/AATCAATGGGCAACGGTTTGTC with the TaqMan probe TQM_SJ2_Coat ACCCAACTCGACCTCGCTCCTGCA were used with the reagent Premix Ex Taq (Probe qPCR; Takara).…”

Section: Methodsmentioning

confidence: 99%

Amino acid changes in the capsid protein of a reassortant betanodavirus strain: Effect on viral replication in vitro and in vivo

Journal of Fish Diseases

Olveira

García-Rosado

et al. 2018

Betanodavirus reassortant strains (RGNNV/SJNNV) isolated from Senegalese sole harbour an SJNNV capsid featuring several changes with respect to the SJNNV‐type strain, sharing three hallmark substitutions. Here, we have employed recombinant strains harbouring mutations in these positions (r20 and r20 + 247 + 270) and have demonstrated that the three substitutions affect different steps of the viral replication process. Adsorption ability and efficiency of viral attachment were only affected by substitutions in the C‐terminal side of the capsid. However, the concurrent mutation in the N‐terminal side seems to slightly decrease these properties, suggesting that this region could also be involved in viral binding. Differences in the intracellular and extracellular production of the mutant strains suggest that both the C‐terminal and N‐terminal regions of the capsid protein may be involved in the particle budding. Furthermore, viral replication in sole brain tissue of the mutant strains, and especially double‐ and triple‐mutant strains, is clearly delayed with respect to the wt strain. These data support previous findings indicating that the C‐terminal side plays a role in virulence because of a slower spread in the fish host brain and suggest that the concurrent participation of the N‐terminal side is also important for viral replication in vivo.