Isolation of Dictyostelium discoideum Cytokinesis Mutants by Restriction Enzyme-Mediated Integration of the Blasticidin S Resistance Marker

Adachi, Hiroyuki; Hasebe, Takeshi; Yoshinaga, Koichi; Ohta, Takao; Sutoh, K.

doi:10.1006/bbrc.1994.2880

Cited by 167 publications

(134 citation statements)

References 0 publications

Supporting

Mentioning

132

Contrasting

Unclassified

Order By: Relevance

“…The disruption construct was assembled in the plasmid pBsr-Nsi. We created pBsr-Nsi from the previously described plasmid pBsr⌬Bam (Adachi et al, 1994) polymerase to remove 3Ј overhangs, and religating. These steps remove a duplicated segment of the actin 8 terminator that was flanked by NsiI sites in pBsr⌬Bam, producing a smaller vector that lacks any NsiI sites.…”

mentioning

confidence: 99%

Identification and Characterization of a Novel α-Kinase with a von Willebrand Factor A-like Motif Localized to the Contractile Vacuole and Golgi Complex inDictyostelium discoideum

Betapudi

Mason

Licate

et al. 2005

MBoC

View full text Add to dashboard Cite

We have identified a new protein kinase in Dictyostelium discoideum that carries the same conserved class of "␣-kinase" catalytic domain as reported previously in myosin heavy chain kinases (MHCKs) in this amoeba but that has a completely novel domain organization. The protein contains an N-terminal von Willebrand factor A (vWFA)-like motif and is therefore named VwkA. Manipulation of VwkA expression level via high copy number plasmids (VwkA ؉؉ cells) or gene disruption (vwkA null cells) results in an array of cellular defects, including impaired growth and multinucleation in suspension culture, impaired development, and alterations in myosin II abundance and assembly. Despite sequence similarity to MHCKs, the purified protein failed to phosphorylate myosin II in vitro. Autophosphorylation activity, however, was enhanced by calcium/calmodulin, and the enzyme can be precipitated from cellular lysates with calmodulin-agarose, suggesting that VwkA may directly bind calmodulin. VwkA is cytosolic in distribution but enriched on the membranes of the contractile vacuole and Golgi-like structures in the cell. We propose that VwkA likely acts indirectly to influence myosin II abundance and assembly behavior and possibly has broader roles than previously characterized ␣ kinases in this organism, which all seem to be MHCKs. INTRODUCTIONNearly all aspects of cell life are regulated by protein phosphorylation involving a large number of biochemical reactions and distinct signaling pathways. Existence of ϳ500 genes encoding various protein kinases in the human genome further underscores their importance in cell life (Manning et al., 2002). Most of these conventional protein kinases belong to serine/threonine/tyrosine, a kinase superfamily whose members carry a conserved catalytic domain with recognizable sequence similarity in spite of having different targets in the cell (Hardie, 1994;Hanks and Hunter, 1995). In recent years, however, biochemical and molecular approaches have led to the identification of more divergent classes of eukaryotic protein kinases carrying a catalytic domain sequence with no sequence similarity with conventional protein kinase catalytic domains (Manning et al., 2002). One major class of unconventional protein kinases was first identified via representatives of myosin heavy chain kinases (MHCKs) in Dictyostelium discoideum (Futey et al., 1995;Côté et al., 1997) and via identification of mammalian eEF-2 kinase (eEF-2K) as an unconventional protein kinase (Ryazanov et al., 1997). This novel, conserved group of unconventional eukaryotic protein kinases has been termed the ␣-kinase family (Ryazanov et al., 1999;Drennan and Ryazanov, 2004).Molecular cloning and biochemical characterization studies demonstrated that at least three Dictyostelium ␣-kinases genes encode enzymes that can specifically phosphorylate myosin II heavy chain (MHC) in vitro and in vivo, and were thus named as MHC kinase A (MHCK A), MHC kinase B (MHCK B) and MHC kinase C (MHCK C) (Futey et al., 1995;Clancy et al., 1997;Luo et al., 200...

show abstract

mentioning

confidence: 99%

Identification and Characterization of a Novel α-Kinase with a von Willebrand Factor A-like Motif Localized to the Contractile Vacuole and Golgi Complex inDictyostelium discoideum

Betapudi

Mason

Licate

et al. 2005

MBoC

View full text Add to dashboard Cite

show abstract

“…Isolation of amiB À mutants and structure of the amiB gene To isolate the genes that regulate early developmental stages including the growth/differentiation transition and the aggregation stage in Dictyostelium, we used the restriction enzyme-mediated integration (REMI) (Kuspa & Loomis 1992;Adachi et al 1994) of a blasticidin resistance marker to randomly mutagenize wild-type cells, and isolated a set of aggregate-less mutants. We screened approximately 40 000 REMImutagenized clones for aggregate-less mutant strains that formed smooth plaques on a bacterial lawn, obtaining 28 clones.…”

Section: Resultsmentioning

confidence: 99%

“…Among them, two independent REMI mutants, R8-2 and R12-3, were selected for further analysis in this study because they had insertions in the same gene and displayed severe defects in the aggregation process such as cAMP-induced production of cAMP and chemotaxis to cAMP, as shown below. From R8-2 and R12-3, the marker DNA and¯anking genomic DNA sequences were cloned by the plasmidrescue method (Kuspa & Loomis 1992;Adachi et al 1994) (Fig. 1A).…”

Section: Resultsmentioning

confidence: 99%

“…For the selection and maintenance of transformants, blasticidin S and/or G418 were used at a ®nal concentration of 10 mg/mL. REMI mutagenesis and selections of aggregation-de®cient mutants were performed exactly as described previously (Adachi et al 1994;Adachi et al 1997;Nagasaki et al 1998;Saito et al 1998). For development in liquid suspension, vegetative cells were harvested from axenic cultures at a cell density of 2,3´10 6 cells/mL.…”

Section: Cell Culture and Developmentmentioning

confidence: 99%

See 1 more Smart Citation

amiB, a novel gene required for the growth/differentiation transition in Dictyostelium

2000

View full text Add to dashboard Cite

Background: The differentiation programme of Dictyostelium discoideum is initiated by starvation. Nutrient depletion triggers the differentiation of Dictyostelium cells through the transcriptional inactivation of some growth-phase genes, as well as through the transcriptional activation of essential genes required for the aggregation of the cells. The adenylyl cyclase (ACA) gene, acaA, is one of the earliest genes expressed following starvation. ACA produces intracellular and extracellular cAMP that drives further differentiation by inducing chemotaxis, developmental gene expression and morphogenesis of Dictyostelium cells. Although several genes have been identi®ed as being essential for the initiation of differentiation process, such as the transcriptional activation of ACA expression, the molecular mechanisms of the growth/differentiation transition remain to be explored.

show abstract

“…To make the disruption construct for Dictyostelium SR gene, the 1.4 kb blasticidin resistance gene (bsr) cassette was digested from pUCBsrDBam plasmid [17] with BamHI and HindIII, blunted at both ends with Klenow fragment and then ligated into the blunted-ended HindIII site of the SR cDNA which had previously been cloned in pGEM T-easy vector [12]. PCR amplification of the SR cDNA or genomic DNA was performed with the primers (forward, aattgttacaggtgcaagtaaaggattt; reverse, ctaaatcataataatctaaatgagaaccagtttc) at an annealing temperature of 55°C.…”

Section: Dna Manipulationmentioning

confidence: 99%

d‐threo‐tetrahydrobiopterin is synthesized via 1′‐oxo‐2′‐d‐hydroxypropyl‐tetrahydropterin inDictyostelium discoideumAx2

et al. 2005

View full text Add to dashboard Cite

Isolation of Dictyostelium discoideum Cytokinesis Mutants by Restriction Enzyme-Mediated Integration of the Blasticidin S Resistance Marker

Cited by 167 publications

References 0 publications

Identification and Characterization of a Novel α-Kinase with a von Willebrand Factor A-like Motif Localized to the Contractile Vacuole and Golgi Complex inDictyostelium discoideum

Identification and Characterization of a Novel α-Kinase with a von Willebrand Factor A-like Motif Localized to the Contractile Vacuole and Golgi Complex inDictyostelium discoideum

amiB, a novel gene required for the growth/differentiation transition in Dictyostelium

d‐threo‐tetrahydrobiopterin is synthesized via 1′‐oxo‐2′‐d‐hydroxypropyl‐tetrahydropterin inDictyostelium discoideumAx2

Contact Info

Product

Resources

About