Joint coding and embedding techniques for multimedia images

Chang, Chin‐Chen; Wu, Wen-Chuan; Chen, Yihui

doi:10.1016/j.ins.2008.05.003

Cited by 28 publications

(14 citation statements)

References 26 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Certainly, the reproduction is the most similar than other codewords in CB. The corresponding index of the found codeword is [8]. Figure 2 shows the illustration of encoding and decoding an image by VQ.…”

Section: Vector Quantizationmentioning

confidence: 99%

“…Here, the techniques of edge detection [9] and VQ compression [8,10,11], are adopted to embed a 2-dimensional QR code as invisible secret data. The situational diagram of QR code for mobile users is shown in Fig.…”

Section: Vector Quantizationmentioning

confidence: 99%

“…Step 2: Cluster the codewords in CB according to the criterion of the Euclidean distance to obtain N/2 pairs almost [8]. Each pair holds only two codewords C i and C j , where Alt(C i ) = C j represents the alternative codeword Step 4: Search the most similar codeword C w from CB for each complex block.…”

Section: Vector Quantizationmentioning

confidence: 99%

See 2 more Smart Citations

Application of QR-Code Steganography Using Data Embedding Technique

Lin

Wong

2013

Lecture Notes in Electrical Engineering

Self Cite

View full text Add to dashboard Cite

Quick response (QR) code is a convenient product for mobile phone user. People can use the Smartphone camera to capture the code, and then decode it through dedicated reader application. Usually the code stands for text, contact information, or a web hyperlink. Users scan the image of QR code to display information or open a website page in the phone's browser. QR codes appear everywhere on posters, publicity flyers, TV advertisements, and even business cards. Since QR code looks like random noise, its existence may hurt the picture of commodities. In this paper, we propose a data embedding scheme to camouflage the existence of QR code. Experimental results showed that the proposed scheme hides the QR code successfully. Moreover, the quality of stego-images is nearly to 30 dB.

show abstract

Section: Vector Quantizationmentioning

confidence: 99%

Section: Vector Quantizationmentioning

confidence: 99%

See 1 more Smart Citation

Application of QR-Code Steganography Using Data Embedding Technique

Lin

Wong

2013

Lecture Notes in Electrical Engineering

Self Cite

View full text Add to dashboard Cite

show abstract

“…For example, assume S is a DNA strand: S= "ATGCTTAGTTCCATCGGAGACTAATGGCCTA" [2] and "two primers ATCAA and GATTAC". So "ATCAA and GATTAC are complementary substring of TAGTT and CTAATG", correspondingly.…”

Section: Balsaminaceaementioning

confidence: 99%

Automatic DNA Sequence Generation for Secured Effective Multi -Cloud Storage

Sureshraj¹

2013

IOSR-JCE

View full text Add to dashboard Cite

show abstract

“…In today's era, there are various digital medias used for developing data hiding techniques including image, video and audio [16,22,26,51]. The most common and traditional way of data hiding media is the image [8,9,17,32,43,44] and the point of interest is hiding messages with the minimum modification rate to avoid corrupting the original image [41,51].…”

mentioning

confidence: 99%

DNA Based Steganography: Survey and Analysis for Parameters Optimization

Hamed

Marey

El-Sayed

et al. 2015

Intelligent Systems Reference Library

View full text Add to dashboard Cite

Nowadays, cryptography and steganography are considered the most famous and secured techniques used in the security field. This chapter introduces a survey on the recent DNA based steganography algorithms that use the DNA as a carrier to enable safe transfer of the critical data over the unsecure network. Some of the recent data hiding techniques based on DNA will be discussed with the main differences between them with respect to some important security parameters such as cracking probability, indicating the algorithm's strength and weakness. However, some of these techniques do not include the computation of the cracking probability, so each of them will be reviewed and then further analyzed to compute its cracking probability. Then, the issues and the problems in these algorithms are presented and discussed with proposing some solutions and recommendations for achieving optimization in the DNA based steganography field.

show abstract

Joint coding and embedding techniques for multimedia images

Cited by 28 publications

References 26 publications

Application of QR-Code Steganography Using Data Embedding Technique

Application of QR-Code Steganography Using Data Embedding Technique

Automatic DNA Sequence Generation for Secured Effective Multi -Cloud Storage

DNA Based Steganography: Survey and Analysis for Parameters Optimization

Contact Info

Product

Resources

About