Junction genetics

Bryant, Peter J.

doi:10.1002/(sici)1520-6408(1997)20:2<75::aid-dvg1>3.0.co;2-5

Cited by 28 publications

(11 citation statements)

References 196 publications

(203 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The apoptosis of the few Mel-CAMlow expressing melanoma cells that did invade the dermis may be due to the lack of such support by keratinocytes or to the lack of gap junctional communication between the malignant cells. The involvement of an adhesion molecule of the Ig family in mediating gap junctions is surprising because Li and Herlyn, 2000;Bryant, 1997). Gap junctions, which facilitate the exchange of small molecules intercellularly (Krutovskikh and Yamasaki, 1997;Yamasaki, 1996) are important in maintaining normal homeostasis of the tissue architecture.…”

Section: Discussionmentioning

confidence: 99%

Mel-CAM-specific genetic suppressor elements inhibit melanoma growth and invasion through loss of gap junctional communication

et al. 2001

View full text Add to dashboard Cite

Normal human melanocytes are interspersed singly among keratinocytes along the basement membrane of the epidermis, whereas melanoma cells readily adhere to each other during invasion of the dermis or distant organs. The tumorigenic and metastatic phenotype of melanoma cells often correlates with increased expression of cell ± cell and cell-matrix adhesion receptors. Mel-CAM (MCAM, MUC 18, CD146) is a cell ± cell adhesion receptor highly expressed by melanoma cells but not normal melanocytes. We show here that inhibition of Mel-CAM expression in metastatic melanoma cells using genetic suppressor elements of Mel-CAM cDNA leads to inhibition of adhesion between melanoma cells and to downregulation of the tumorigenic phenotype. Growth was not inhibited in genetic suppressor elements-transduced melanoma cells cultured in monolayers but was inhibited when cells were maintained anchorage-independently in soft agar and greatly reduced in immunode®cient mice. A threedimensional epidermal skin equivalent model demonstrated that Mel-CAM allows melanoma cells to separate from the epidermis and invade the basement membrane zone and dermis. However, melanoma cells with little or no Mel-CAM were poorly invasive, possibly due to their loss of gap junctional communication. These results suggest the multifunctional role of a melanomaassociated cell ± cell adhesion receptor in tumor progression. Oncogene (2001) 20, 4676 ± 4684.

show abstract

Section: Discussionmentioning

confidence: 99%

Mel-CAM-specific genetic suppressor elements inhibit melanoma growth and invasion through loss of gap junctional communication

et al. 2001

View full text Add to dashboard Cite

show abstract

“…The newly engineered Pg construct was subcloned into the SalI/HindIII sites of the mammalian expression vector LK 444 generating the vector p730. The triple point mutant Pg Phe-693, Phe-724, and Phe-729 was generated by PCR amplification following a similar strategy using the following primers and p240 as template for the PCR: LNPg143, 5ЈGCATGATTCCCATCAATGAGCCCTTTGG3Ј (GATTCCCATC, BsaB1, TTT, Phe-693); LNPg144, 5ЈCGCTGAA 1 The resulting 219-base pair PCR product contains a 5Ј BsaB1 and a 3Ј HindIII restriction site. These engineered sites were used to subclone the cDNA fragment into the BsaB1 and HindIII sites of p240 creating a C-terminally Myc-tagged triple point mutant Pg, which was checked by sequence analysis.…”

Section: Methodsmentioning

confidence: 99%

“…Modulation of adhesive junctions plays a critical role during development and wound healing (1)(2)(3). Moreover, the ability of cells to down-regulate or alter the adhesive capabilities of their cell-cell junctions is a contributing factor during tumor metastasis (4).…”

mentioning

confidence: 99%

“…Several lines of evidence suggest that tyrosine phosphorylation of the cadherin-catenin complex down-regulates cell adhesion and possibly the association of cadherin-catenin complexes with the cytoskeleton (5)(6)(7)(8)(9)(10)(11). In addition, plakoglobin (Pg) 1 and ␤-catenin have been reported to associate with the tyrosine kinases c-ErbB-2, the epidermal growth factor receptor (EGFR) (12)(13), and protein-tyrosine phosphatases PTP (14) and LAR (15). These data suggest that these members of the armadillo family of proteins may function as modulatable components within complex adhesive structures allowing for rapid responses to intracellular or extracellular signals.…”

mentioning

confidence: 99%

See 1 more Smart Citation

Tyrosine-phosphorylated Plakoglobin Is Associated with Desmogleins but Not Desmoplakin after Epidermal Growth Factor Receptor Activation

Gaudry

Palka

Dusek

et al. 2001

Journal of Biological Chemistry

View full text Add to dashboard Cite

Tyrosine phosphorylation of junctional components has been proposed as a mechanism for modulating cellcell adhesion. Although a correlation exists between the tyrosine phosphorylation of the adherens junction protein ␤-catenin and loss of classical cadherin-mediated adhesion, the effects of tyrosine phosphorylation on the function of the adherens junction and desmosome-associated protein plakoglobin is unknown. In the present study, we investigated the effects of epidermal growth factor receptor (EGFR) tyrosine kinase activation on the subcellular distribution of plakoglobin and its association with its junctional binding partners. Long term epidermal growth factor (EGF) treatment of A431 cells revealed a modest decrease in the cytoskeleton-associated pool of plakoglobin (Pg) and a corresponding increase in the cytosolic pool of Pg. After short term EGF treatment, plakoglobin was rapidly phosphorylated, and tyrosine-phosphorylated Pg was distributed predominantly in a membrane-associated Triton X-100-soluble pool, along with a co-precipitating high molecular weight tyrosine-phosphorylated protein identified as desmoglein 2. Analysis of deletion and point mutants defined the primary EGFR-dependent targets as one or more of three C-terminal tyrosine residues. Whereas phosphorylated Pg remained associated with the desmoglein tail after both short and long term EGFR activation, no phosphorylated Pg was found associated with the N-terminal Pg-binding domain (DPNTP) of the intermediate filament-associated protein, desmoplakin. Together these results are consistent with the possibility that EGF-dependent tyrosine phosphorylation of Pg may modulate cell-cell adhesion by compromising the link between desmosomal cadherins and the intermediate filament cytoskeleton.Modulation of adhesive junctions plays a critical role during development and wound healing (1-3). Moreover, the ability of cells to down-regulate or alter the adhesive capabilities of their cell-cell junctions is a contributing factor during tumor metastasis (4). However, the exact mechanisms that regulate intercellular adhesion during these processes are not well understood. Tyrosine phosphorylation of junctional components, and in particular phosphorylation of members of the armadillo family of proteins, has been proposed as a critical step in modulating cell-cell adhesion. Several lines of evidence suggest that tyrosine phosphorylation of the cadherin-catenin complex down-regulates cell adhesion and possibly the association of cadherin-catenin complexes with the cytoskeleton (5-11). In addition, plakoglobin (Pg) 1 and ␤-catenin have been reported to associate with the tyrosine kinases c-ErbB-2, the epidermal growth factor receptor (EGFR) (12-13), and protein-tyrosine phosphatases PTP (14) and LAR (15). These data suggest that these members of the armadillo family of proteins may function as modulatable components within complex adhesive structures allowing for rapid responses to intracellular or extracellular signals.In certain cell types, tyrosine phosphory...

show abstract

“…Dlg is localized at the lateral contacts between cells at the septate junctions, an invertebrate-speci®c junction that could be the functional homolog of the vertebrate tight junction (Bryant, 1997). A human homologue of Dlg, HDLG, binds directly to the 4.1 protein and to the product of the APC tumor suppressor gene (Lue et al, 1994;Matsumine et al, 1996).…”

Section: Introductionmentioning

confidence: 99%

Mutations in the β-propeller domain of the Drosophila brain tumor (brat) protein induce neoplasm in the larval brain

et al. 2000

View full text Add to dashboard Cite

Inactivation of both alleles of the fruit¯y D. melanogaster brain tumor (brat) gene results in the production of a tumor-like neoplasm in the larval brain, and lethality in the larval third instar and pupal stages. We cloned the brat gene from a transposon-tagged allele and identi®ed its gene product. brat encodes for an 1037 amino acid protein with an N-terminal B-box1 zinc ®nger followed by a B-box2 zinc ®nger, a coiled-coil domain, and a C-terminal b-propeller domain with six blades. All these motifs are known to mediate protein ± protein interactions. Sequence analysis of four brat alleles revealed that all of them are mutated at the bpropeller domain. The clustering of mutations in this domain strongly suggests that it has a crucial role in the normal function of Brat, and de®nes a novel protein motif involved in tumor suppression activity. The brat gene is expressed in the embryonic central and peripheral nervous systems including the embryonic brain. In third instar larva brat expression was detected in the larval central nervous system including the brain and the ventral ganglion, in two glands ± the ring gland and the salivary gland, and in parts of the foregut ± the gastric caecae and the proventriculus. A second brat-like gene was found in D. melanogaster, and homologs were identi®ed in the nematode, mouse, rat, and human. Accumulated data suggests that Brat may regulate proliferation and di erentiation by secretion/transportmediated processes.

show abstract

Junction genetics

Cited by 28 publications

References 196 publications

Mel-CAM-specific genetic suppressor elements inhibit melanoma growth and invasion through loss of gap junctional communication

Mel-CAM-specific genetic suppressor elements inhibit melanoma growth and invasion through loss of gap junctional communication

Tyrosine-phosphorylated Plakoglobin Is Associated with Desmogleins but Not Desmoplakin after Epidermal Growth Factor Receptor Activation

Mutations in the β-propeller domain of the Drosophila brain tumor (brat) protein induce neoplasm in the larval brain

Contact Info

Product

Resources

About