KCNQ Potassium Channels Modulate Sensitivity of Skin Down-hair (D-hair) Mechanoreceptors

Schütze, Sebastian; Orozco, Ian J.; Jentsch, Thomas J.

doi:10.1074/jbc.m115.681098

Cited by 21 publications

(31 citation statements)

References 65 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Mice with genetic deletion of Kcnq2 in cells derived from the neural crest (including DRG neurons) displayed both thermal and mechanical hyperalgesia (King et al, ). Consistently, in another study, mice with global genetic deletion of K v 7.3 ( Kcnq3 −/− ) and down‐regulation of K v 7.2 ( Kcnq2 +/− ) displayed increased firing rates of mechanosenstive D‐hairs (Aδ‐low‐threshold mechanoreceptors) in response to mechanical stimulation (Schutze et al, ). Yet the effect was modest and no obvious behavioural phenotype was reported (although this could have been due to only partial loss of K v 7.2).…”

Section: Channels and Peripheral Fibre Excitability In Vitro In Simentioning

confidence: 98%

M‐type K⁺ channels in peripheral nociceptive pathways

Gao

Jaffe

et al. 2017

British J Pharmacology

View full text Add to dashboard Cite

Pathological pain is a hyperexcitability disorder. Since the excitability of a neuron is set and controlled by a complement of ion channels it expresses, in order to understand and treat pain, we need to develop a mechanistic insight into the key ion channels controlling excitability within the mammalian pain pathways and how these ion channels are regulated and modulated in various physiological and pathophysiological settings. In this review, we will discuss the emerging data on the expression in pain pathways, functional role and modulation of a family of voltage‐gated K+ channels called ‘M channels’ (KCNQ, Kv7). M channels are increasingly recognized as important players in controlling pain signalling, especially within the peripheral somatosensory system. We will also discuss the therapeutic potential of M channels as analgesic drug targets.Linked ArticlesThis article is part of a themed section on Recent Advances in Targeting Ion Channels to Treat Chronic Pain. To view the other articles in this section visit http://onlinelibrary.wiley.com/doi/10.1111/bph.v175.12/issuetoc/

show abstract

Section: Channels and Peripheral Fibre Excitability In Vitro In Simentioning

confidence: 98%

M‐type K⁺ channels in peripheral nociceptive pathways

Gao

Jaffe

et al. 2017

British J Pharmacology

View full text Add to dashboard Cite

show abstract

“…compound (Sakura), and 16-m cryosections were cut. Digoxigenin-labeled in situ hybridization was performed as described previously (37). The following primers were used for synthesis of RNA hybridization probes from murine cDNA: Ano1, CCACAGCCCGTGCCAGTCAC (forward) and GCCG-ACCAACAAACCGGCCT (reverse); and Ano2, TTACCAAA-ATCGAGGTTCCG (forward) and AACCTCCTGGTCGAA-CTGTG (reverse).…”

Section: Ca 2؉ -Activated CL ؊ Currents In the Vomeronasal Organ In Smentioning

confidence: 99%

Ca2+-activated Cl− currents in the murine vomeronasal organ enhance neuronal spiking but are dispensable for male–male aggression

Münch

Billig

Hübner

et al. 2018

Journal of Biological Chemistry

Self Cite

View full text Add to dashboard Cite

Ca-activated Cl currents have been observed in many physiological processes, including sensory transduction in mammalian olfaction. The olfactory vomeronasal (or Jacobson's) organ (VNO) detects molecular cues originating from animals of the same species or from predators. It then triggers innate behaviors such as aggression, mating, or flight. In the VNO, Ca-activated Cl channels (CaCCs) are thought to amplify the initial pheromone-evoked receptor potential by mediating a depolarizing Cl efflux. Here, we confirmed the co-localization of the Ca-activated Cl channels anoctamin 1 (Ano1, also called TMEM16A) and Ano2 (TMEM16B) in microvilli of apically and basally located vomeronasal sensory neurons (VSNs) and their absence in supporting cells of the VNO. Both channels were expressed as functional isoforms capable of giving rise to Ca-activated Cl currents. Although these currents persisted in the VNOs of mice lacking , they were undetectable in olfactory neuron-specific knockout mice irrespective of the presence of The loss of Ca-activated Cl currents resulted in diminished spontaneous and drastically reduced pheromone-evoked spiking of VSNs. Although this indicated an important role of anoctamin channels in VNO signal amplification, the lack of this amplification did not alter VNO-dependent male-male territorial aggression in olfactory / double knockout mice. We conclude that Ano1 mediates the bulk of Ca-activated Cl currents in the VNO and that Ano2 plays only a minor role. Furthermore, vomeronasal signal amplification by CaCCs appears to be dispensable for the detection of male-specific pheromones and for near-normal aggressive behavior in mice.

show abstract

“…As tail currents in Aδ neurons are primarily mediated by KCNQ2/3 potassium channels 30,31 , we postulated that S1P may alter tail currents through modulation of these channels. Furthermore, the above properties of the S1P-sensitive current were consistent with the reported electrophysiological properties of KCNQ2/3 channels in DRG neurons 30,32,33 . To address whether KCNQ2/3 channels mediated S1P-dependent neuronal excitability, we applied the KCNQ2/3-selective inhibitor XE 991 and found that it completely occluded the effects of S1P on tail current ( Figure 5D ).…”

Section: Resultsmentioning

confidence: 99%

“…GPCR-mediated inhibition of KCNQ2/3 potassium channels is a well-known mechanism by which neuronal excitability is regulated 46 . Other studies have shown that KCNQ channels mediate excitability of Aδ fibers 30,31 and are required for normal mechanonociceptive responses in dorsal horn neurons receiving Aδ input 31 , and that opening KCNQ2/3 channels directly with retigabine alleviates pain in vivo 33,47,48 . Our results not only complement previous work implicating KCNQ2/3 channels in pain, but also define the upstream mechanisms that promote the regulation of KCNQ2/3 channels to tune mechanical pain thresholds.…”

Section: Discussionmentioning

confidence: 99%

“…For mechanonociceptors experiments, only cells which were visually identified as mCherry expressing and which had a capacitance between 40-80 pF were used. Rheobase was calculated as the smallest current step required to elicit an action potential using current steps of 50 pA. M currents were measured and analyzed using standard protocols for DRG neurons reported in the literature 30,32,73 . Experiments were carried out only on cells with a series resistance of less than 30 MQ.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

The signaling lipid sphingosine 1-phosphate regulates mechanical pain

Hill

Hoffman

Morita

et al. 2017

Preprint

View full text Add to dashboard Cite

40Somatosensory neurons mediate responses to diverse mechanical stimuli, from innocuous 41 touch to noxious pain. While recent studies have identified distinct populations of A 42 mechanonociceptors (AMs) that are required for mechanical pain, the molecular underpinnings 43 of mechanonociception remain unknown. Here, we show that the bioactive lipid sphingosine 1-44 phosphate (S1P) and S1P Receptor 3 (S1PR3) are critical regulators of acute 45 mechanonociception. Genetic or pharmacological ablation of S1PR3, or blockade of S1P 46 production, significantly impaired the behavioral response to noxious mechanical stimuli, with no 47 effect on responses to innocuous touch or thermal stimuli. These effects are mediated by fast-48 conducting Aδ mechanonociceptors, which displayed a significant decrease in 49 mechanosensitivity in S1PR3 mutant mice. We show that S1PR3 signaling tunes 50 mechanonociceptor excitability via modulation of KCNQ2/3 channels. Our findings define a new 51 role for S1PR3 in regulating neuronal excitability and establish the importance of S1P/S1PR3 52 signaling in the setting of mechanical pain thresholds. 53 54

show abstract

KCNQ Potassium Channels Modulate Sensitivity of Skin Down-hair (D-hair) Mechanoreceptors

Cited by 21 publications

References 65 publications

M‐type K⁺ channels in peripheral nociceptive pathways

M‐type K⁺ channels in peripheral nociceptive pathways

Ca2+-activated Cl− currents in the murine vomeronasal organ enhance neuronal spiking but are dispensable for male–male aggression

The signaling lipid sphingosine 1-phosphate regulates mechanical pain

Contact Info

Product

Resources

About

KCNQ Potassium Channels Modulate Sensitivity of Skin Down-hair (D-hair) Mechanoreceptors

Cited by 21 publications

References 65 publications

M‐type K+ channels in peripheral nociceptive pathways

M‐type K+ channels in peripheral nociceptive pathways

Ca2+-activated Cl− currents in the murine vomeronasal organ enhance neuronal spiking but are dispensable for male–male aggression

The signaling lipid sphingosine 1-phosphate regulates mechanical pain

Contact Info

Product

Resources

About

M‐type K⁺ channels in peripheral nociceptive pathways

M‐type K⁺ channels in peripheral nociceptive pathways