Kinase-dependent structural role of DNA-PKcs during immunoglobulin class switch recombination

Abstract

The catalytic subunit of DNA-dependent protein kinase (DNA-PKcs) is a classical nonhomologous end-joining (cNHEJ) factor. Loss of DNA-PKcs diminished mature B cell class switch recombination (CSR) to other isotypes, but not IgG1. Here, we show that expression of the kinase-dead DNA-PKcs ( ) severely compromises CSR to IgG1. High-throughput sequencing analyses of CSR junctions reveal frequent accumulation of nonproductive interchromosomal translocations, inversions, and extensive end resection in , but not , B cells. Meanwhile, the residual joints from cells and the efficient Sµ-Sγ1 junctions from B cells both display similar preferences for small (2-6 nt) microhomologies (MH). In cells, Sµ-Sγ1 joints are more resistant to inversions and extensive resection than Sµ-Sε and Sµ-Sµ joints, providing a mechanism for the isotype-specific CSR defects. Together, our findings identify a kinase-dependent role of DNA-PKcs in suppressing MH-mediated end joining and a structural role of DNA-PKcs protein in the orientation of CSR.

DNA-PKcs phosphorylation at the T2609 cluster alters the repair pathway choice during immunoglobulin class switch recombination

“…To understand the role of DNA-PKcs T2609 phosphorylation in CSR, we purified splenic B cells from DNA-PKcs 5A/5A Tp53 +/-(or -/-) and control DNA-PKcs +/+ or Tp53 +/-(or -/-) mice and cultured them with anti-CD40 and interleukin 4 (IL-4) that induce robust CSR to IgG1 and IgE. Tp53 -deficiency does not affect CSR efficiency or CSR junctions (16, 17, 44, 45). About 20% DNA-PKcs +/+ B cells were IgG1+ after 3 days of stimulation and ~37% IgG1+ by day 4 (Fig.1C and 1D).…”

“…Given DNA-PKcs -/- B cells undergo efficient CSR to IgG1 via the Alt-EJ mediated repair pathway, as detected by the HTGTS of Sμ-Sμ internal deletions and Sμ-Sγ1 CSR junctions (16), we decided to analyze the CSR junctions in DNA-PKcs 5A/5A p53 +/-(or -/-) B cells using the sensitive HTGTS. Briefly “translocation junctions” from a single bait site at the 5’Sμ to various targets were isolated after linear amplification and sequenced (Fig.…”

“…Consistent with DNA-PKcs and Artemis being dispensable for direct end-ligation, DNA-PKcs -/- B cells only have moderate defects in CSR (14, 15). Nevertheless, in recent high-throughput sequence analyses, we found that CSR junctions recovered from DNA-PKcs -/- B cells contained increased chromosomal translocations and extensive end-resection, and preferentially used MHs (16), suggesting that the seemingly robust CSR achieved in DNA-PKcs -/- cells is primarily mediated by the Alt-EJ pathway like those in Lig4 -/- or Xrcc4 -/- B cells (17, 18). Accordingly, human patients with spontaneous mutations in DNA-PKcs show severe defects in both V(D)J recombination and CSR and increased MH in the residual CSR junctions(12, 19).…”

“…HTGTS was performed as described (16, 41). Briefly, genomic DNA was collected from activated B cells 4 days after stimulation, sonicated (Diagenode Bioruptor), and amplified with an Sμ specific biotinylated primer (5’/5BiosG/CAGACCTGGGAATGTATGGT3’) and nested primer (5’CACACAAAGACTCTGGACCTC3’).…”

“…KU deletion rescued the embryonic development of DNA-PKcs KD/KD mice, suggesting that DNA-PKcs has an end-capping function at the DNA ends that is regulated by its kinase activity. Correspondingly, DNA-PKcs KD/KD mature B cells display severe CSR defects like Lig4 -/- B cells (16) and the residual CSR junctions from DNA-PKcs KD/KD B cells are all mediated by the Alt-EJ pathway…”