KIR3DL2: diversity in a hematopoietic stem cell transplant population

Gedil, Melaku; Steiner, Noriko; Hurley, Carolyn Katovich

doi:10.1111/j.1399-0039.2007.00880.x

Cited by 11 publications

(6 citation statements)

References 14 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Participating laboratories utilized different genotyping methodologies, including sequence-specific-oligonucleotide (SSO) hybridization, sequence-specific-primer typing (SSP), and DNA sequencing [16], [17], [34], [35], [36], [37], [38], [39], [40], [41], [42], [43]. Results were interpreted to a three-digit allele designation using the Immuno Polymorphism Database- KIR version 1.2.0 or higher [44].…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Allele-Level Haplotype Frequencies and Pairwise Linkage Disequilibrium for 14 KIR Loci in 506 European-American Individuals

Vierra-Green¹,

et al. 2012

View full text Add to dashboard Cite

The immune responses of natural killer cells are regulated, in part, by killer cell immunoglobulin-like receptors (KIR). The 16 closely-related genes in the KIR gene system have been diversified by gene duplication and unequal crossing over, thereby generating haplotypes with variation in gene copy number. Allelic variation also contributes to diversity within the complex. In this study, we estimated allele-level haplotype frequencies and pairwise linkage disequilibrium statistics for 14 KIR loci. The typing utilized multiple methodologies by four laboratories to provide at least 2x coverage for each allele. The computational methods generated maximum-likelihood estimates of allele-level haplotypes. Our results indicate the most extensive allele diversity was observed for the KIR framework genes and for the genes localized to the telomeric region of the KIR A haplotype. Particular alleles of the stimulatory loci appear to be nearly fixed on specific, common haplotypes while many of the less frequent alleles of the inhibitory loci appeared on multiple haplotypes, some with common haplotype structures. Haplotype structures cA01 and/or tA01 predominate in this cohort, as has been observed in most populations worldwide. Linkage disequilibrium is high within the centromeric and telomeric haplotype regions but not between them and is particularly strong between centromeric gene pairs KIR2DL5∼KIR2DS3S5 and KIR2DS3S5∼KIR2DL1, and telomeric KIR3DL1∼KIR2DS4. Although 93% of the individuals have unique pairs of full-length allelic haplotypes, large genomic blocks sharing specific sets of alleles are seen in the most frequent haplotypes. These high-resolution, high-quality haplotypes extend our basic knowledge of the KIR gene system and may be used to support clinical studies beyond single gene analysis.

show abstract

Section: Methodsmentioning

confidence: 99%

“…Novel alleles (Table S1) were isolated for DNA sequencing using allele specific amplification, by cloning, or by using HaploPrep reagents (Qiagen, Valencia, CA) as previously described [39], [40], [42], [43], [47], [48]. Two or three overlapping PCR amplicons were generated from each KIR gene covering the complete coding sequence.…”

Section: Methodsmentioning

confidence: 99%

Allele-Level Haplotype Frequencies and Pairwise Linkage Disequilibrium for 14 KIR Loci in 506 European-American Individuals

Vierra-Green¹,

et al. 2012

View full text Add to dashboard Cite

show abstract

“…(16). An amplicon including exon 4 through exon 9 of the KIR3DL1/KIR3DL2 alleles was amplified by primers 3DL1 SSPF (17) and 3DL2 Exon9R (GGCTGTTGTCTCCCTAGAAA) (18). Together, the KIR3DL1 amplicons included exon 1 through the 3′ untranslated region (UTR) covering a region of approximately 14,700 base pairs.…”

Section: Frequency On Kir3dl1 and Kir3ds1 Allelesa In Unrelated Africmentioning

confidence: 99%

The profile of KIR3DL1 and KIR3DS1 alleles in an African American population resembles that found in African populations

et al. 2010

Self Cite

View full text Add to dashboard Cite

KIR3DL1 and KIR3DS1 allele frequencies were determined by DNA sequencing of the complete coding regions from 100 random unrelated African Americans. Alleles 3DL1 *01501 (29 individuals) and 3DL1*01502 (23 individuals) were most frequently observed in addition to 21 other known alleles and seven new alleles: KIR3DL1*01503, *03102, *064, *065, *066, *067, and *068. Two of the new alleles (KIR3DL1*064, *065) created additional variants of the chimeric KIR3DL1/KIR3DL2 gene. KIR3DS1*01301 (94% of the gene positive individuals) and KIR3DS1*049N (11%) were identified in the 18 individuals carrying this gene. Three individuals appeared to carry a KIR haplotype with a KIR3DL1/S1 duplication. The profile of alleles resembles that found in African populations but also shows signs of admixture.

show abstract

“…The most frequent KIR3DL2 allele in a population of 75 Caucasians was KIR3DL2*002 (26.1%), followed by KIR3DL2*001 and KIR3DL2*007 (21.0% and 18.8%). [14] While KIR3DL2*002 was found at similarly high frequencies in both TCGA (9.85%) and UK Biobank (9.27%) as the 2 nd and 3 rd most frequent KIR3DL2 alleles respectively, KIR3DL2*001 and KIR3DL2*007 were much lower ranked at 8 th and 9 th in TCGA and 8 th and 1st in UK Biobank respectively. However, these are still fairly well-represented alleles at 4.94% and 2.67% frequency in TCGA and 5.12% and 13.3% frequency in UK biobank respectively.…”

Section: Resultsmentioning

confidence: 99%

KIRCLE: An Analysis of Variations in KIR Genes in The Cancer Genome Atlas and UK Biobank

Gao

Liu

Zhan

et al. 2021

Preprint

View full text Add to dashboard Cite

Background: Natural killer (NK) cells represent a critical component of the innate immune system response against cancer and viral infections, among other diseases. To distinguish healthy host cells from infected or tumor cells, killer immunoglobulin receptors (KIR) on NK cells bind and recognize Human Leukocyte Antigen (HLA) complexes on their target cells. Just like the HLAs they bind, these KIRs exhibit high allelic diversity in the human population. Results: In order to better understand these immunoreceptors, we have developed KIRCLE, a novel method for genotyping individual KIR genes from whole exome sequencing data, and used it to analyze approximately 60,000 patient samples in The Cancer Genome Atlas and UK Biobank. We were able to assess population frequencies for different KIR alleles and demonstrate that, similar to HLA alleles, KIR alleles of different individuals correlate strongly with their ethnicities. In addition, we observed associations between different KIR alleles and HLA alleles, including HLA-B*53 with KIR3DL2*013 (Fisher Exact FDR = 7.64e-51). Finally, we showcased statistically significant associations between KIR alleles and various clinical correlates, including peptic ulcer disease (Fisher Exact FDR = 0.0429) and age of onset of atopy and various KIR alleles (Mann-Whitney-U FDR = 0.0751). Conclusions: KIR polymorphism and NK cells play a critical role in many diseases, often through their interactions with HLA complexes. Peptic ulcer disease and atopy are just two diseases in which NK cells may play a role beyond their classical realm of anti-tumor and anti-viral responses.

show abstract

KIR3DL2: diversity in a hematopoietic stem cell transplant population

Cited by 11 publications

References 14 publications

Allele-Level Haplotype Frequencies and Pairwise Linkage Disequilibrium for 14 KIR Loci in 506 European-American Individuals

Allele-Level Haplotype Frequencies and Pairwise Linkage Disequilibrium for 14 KIR Loci in 506 European-American Individuals

The profile of KIR3DL1 and KIR3DS1 alleles in an African American population resembles that found in African populations

KIRCLE: An Analysis of Variations in KIR Genes in The Cancer Genome Atlas and UK Biobank

Contact Info

Product

Resources

About