Knock-in fibroblasts and transgenic blastocysts for expression of human FGF2 in the bovine β-casein gene locus using CRISPR/Cas9 nuclease-mediated homologous recombination

Abstract

Many transgenic domestic animals have been developed to produce therapeutic proteins in the mammary gland, and this approach is one of the most important methods for agricultural and biomedical applications. However, expression and secretion of a protein varies because transgenes are integrated at random sites in the genome. In addition, distal enhancers are very important for transcriptional gene regulation and tissue-specific gene expression. Development of a vector system regulated accurately in the genome is needed to improve production of therapeutic proteins. The objective of this study was to develop a knock-in system for expression of human fibroblast growth factor 2 (FGF2) in the bovine β-casein gene locus. The F2A sequence was fused to the human FGF2 gene and inserted into exon 3 of the β-casein gene. We detected expression of human FGF2 mRNA in the HC11 mouse mammary epithelial cells by RT-PCR and human FGF2 protein in the culture media using western blot analysis when the knock-in vector was introduced. We transfected the knock-in vector into bovine ear fibroblasts and produced knock-in fibroblasts using the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system. Moreover, the CRISPR/Cas9 system was more efficient than conventional methods. In addition, we produced knock-in blastocysts by somatic cell nuclear transfer using the knock-in fibroblasts. Our knock-in fibroblasts may help to create cloned embryos for development of transgenic dairy cattle expressing human FGF2 protein in the mammary gland via the expression system of the bovine β-casein gene.

Crotamine, a cell-penetrating peptide, is able to translocate parthenogenetic and in vitro fertilized bovine embryos but does not improve exogenous DNA expression

“…However, the efficiency of these techniques still remains low. In order to improve efficiency in farm animals, some vector modification-based approaches, such as transposon [17] and CRISPR/Cas9 systems [18], gained increasing interests in recent years. However, efficient tools for the delivery of vector DNA still need more studies.…”

Relationship between DNA mismatch repair and CRISPR/Cas9-mediated knock-in in the bovine β-casein gene locus

“…A r t i c l e kb 3' arm fragment is homologous to a region of exon in the β-casein gene and starts exactly from the Cas9/sgRNA cleavage site, which was previously reported by Jeong et al [21]. PCR was performed using the bβCE3 II S primer (AAGCTTACCTGGTGAGGTAAGATATTTTTAT) and the bβCE3 1kbPHR II AS primer (GTCGACCAGATTTAGGACTACACTCA), containing HindIII and SalI restriction enzyme sites using KOD FX Neo (Toyobo, Osaka, Japan).…”

Production of Recombinant Proteins in the Milk of Transgenic Animals: Current State and Prospects

“…Integration of the cassette with recombination sites directly into the gene encoding the milk protein enables the expression of the target transgene, thus providing the production of the recombinant protein into the milk under the control of an endogenous promoter whose activity is specific to mammary cells [45]. The promoter of the β-casein encoding gene (gene for integration) [46-48] can be used for this purpose; lack of this gene does not affect normal lactation [49, 50].…”