Knock-In Strategy for Editing Human and Zebrafish Mitochondrial DNA Using Mito-CRISPR/Cas9 System

Bian, Wan-Ping; Chen, Yanling; Luo, Juanjuan; Wang, Chao; Xie, Shaolin; Pei, De‐Sheng

doi:10.1021/acssynbio.8b00411

Cited by 59 publications

(53 citation statements)

References 59 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Unsurprisingly, there are many known mechanisms of protein transport into different mitochondrial subcompartments (Pfanner et al, 2019). We (Orishchenko et al, 2016) and others (Jo et al, 2015;Loutre et al, 2018;Bian et al, 2019) have demonstrated that introduction of a mitochondrial localization signal at the N-terminus of Cas9 leads to an effective Cas9 import into mitochondrial matrix. Therefore, protein component of CRISPR/Cas9 system could be imported inside mitochondria.…”

Section: Discussionmentioning

confidence: 99%

Study of the effect of the introduction of mitochondrial import determinants into the gRNA structure on the activity of the gRNA/SpCas9 complex in vitro

Zakirova

Vyatkin²,

Verechshagina

et al. 2020

Vestn. VOGiS

View full text Add to dashboard Cite

It has long been known that defects in the structure of the mitochondrial genome can cause various neuromuscular and neurodegenerative diseases. Nevertheless, at present there is no effective method for treating mitochondrial diseases. The major problem with the treatment of such diseases is associated with mitochondrial DNA (mtDNA) heteroplasmy. It means that due to a high copy number of the mitochondrial genome, mutant copies of mtDNA coexist with wild-type molecules in the same organelle. The clinical symptoms of mitochondrial diseases and the degree of their manifestation directly depend on the number of mutant mtDNA molecules in the cell. The possible way to reduce adverse effects of the mutation is by shifting the level of heteroplasmy towards the wild-type mtDNA molecules. Using this idea, several gene therapeutic approaches based on TALE and ZF nucleases have been developed for this purpose. However, the construction of protein domains of such systems is rather long and laborious process. Meanwhile, the CRISPR/Cas9 system is fundamentally different from protein systems in that it is easy to use, highly efficiency and has a different mechanism of action. All the characteristics and capabilities of the CRISPR/Cas9 system make it a promising tool in mitochondrial genetic engineering. In this article, we demonstrate for the first time that the modification of gRNA by integration of specific mitochondrial import determinants in the gRNA scaffold does not affect the activity of the gRNA/Cas9 complex in vitro.

show abstract

Section: Discussionmentioning

confidence: 99%

Study of the effect of the introduction of mitochondrial import determinants into the gRNA structure on the activity of the gRNA/SpCas9 complex in vitro

Zakirova

Vyatkin²,

Verechshagina

et al. 2020

Vestn. VOGiS

View full text Add to dashboard Cite

show abstract

“…To help explain this surprising result, the authors present data showing that the CRISPR/Cas9 system appears to significantly upregulate several of the major proteins involved in nuclear DNA repair. 66 Once again, however, the precise mechanism remains unclear. Most critically, it has not been clearly demonstrated that the nuclear DNA repair enzymes are even imported into the mitochondria, nor that they can effectively assemble and operate properly within the mitochondrial matrix, which would be an obvious mechanistic prerequisite for any homologous recombination events to be able to occur.…”

Section: Mitochondrial Replacement Therapy (Mrt)mentioning

confidence: 99%

The special considerations of gene therapy for mitochondrial diseases

Slone

Huang

2020

npj Genom. Med.

View full text Add to dashboard Cite

The recent success of gene therapy across multiple clinical trials has inspired a great deal of hope regarding the treatment of previously intractable genetic diseases. This optimism has been extended to the prospect of gene therapy for mitochondrial disorders, which are not only particularly severe but also difficult to treat. However, this hope must be tempered by the reality of the mitochondrial organelle, which possesses specific biological properties that complicate genetic manipulation. In this perspective, we will discuss some of these complicating factors, including the unique pathways used to express and import mitochondrial proteins. We will also present some ways in which these challenges can be overcome by genetic manipulation strategies tailored specifically for mitochondrial diseases.

show abstract

“…Three primers, F1 (5' TCTATTCATCGTCTCGGAAG 3'), F2 (5' TACC ATTCCTAACAGGGTTC 3') and R (5' TTTATGGGTGTAATGCGGTG 3'), were synthesized by the Beijing Genomics Institute (Beijing, China). Primer F1/R was used to amplify the deleted mtDNA fragment, while F2/R to wild-type mtDNA sequence [43,44]. All of the three primers were added to the reaction system for PCR.…”

Section: Quantification Of Deleted Mtdna In Aged Micementioning

confidence: 99%

Improvement of cognitive and motor performance with mitotherapy in aged mice

Zhao

Hou

et al. 2020

Int. J. Biol. Sci.

View full text Add to dashboard Cite

Changes in mitochondrial structure and function are mostly responsible for aging and age-related features. Whether healthy mitochondria could prevent aging is, however, unclear. Here we intravenously injected the mitochondria isolated from young mice into aged mice and investigated the mitotherapy on biochemistry metabolism and animal behaviors. The results showed that heterozygous mitochondrial DNA (mtDNA) of both aged and young mouse coexisted in tissues of aged mice after mitochondrial administration, and meanwhile, ATP content in tissues increased while reactive oxygen species (ROS) level reduced. Besides, the mitotherapy significantly improved cognitive and motor performance of aged mice. Our study, at the first report in aged animals, not only provides a useful approach to study mitochondrial function associated with aging, but also a new insight into anti-aging through mitotherapy.

show abstract

Knock-In Strategy for Editing Human and Zebrafish Mitochondrial DNA Using Mito-CRISPR/Cas9 System

Cited by 59 publications

References 59 publications

Study of the effect of the introduction of mitochondrial import determinants into the gRNA structure on the activity of the gRNA/SpCas9 complex in vitro

Study of the effect of the introduction of mitochondrial import determinants into the gRNA structure on the activity of the gRNA/SpCas9 complex in vitro

The special considerations of gene therapy for mitochondrial diseases

Improvement of cognitive and motor performance with mitotherapy in aged mice

Contact Info

Product

Resources

About