Knockdown of RNF6 inhibits gastric cancer cell growth by suppressing STAT3 signaling

Huang, Ziming; Cai, Yong; Yang, Chengli; Chen, Zhen; Sun, Hong; Xu, Yingying; Chen, Wei; Xu, Danyan; Wang, Tian; Wang, Haixiao

doi:10.2147/ott.s174846

Cited by 30 publications

(27 citation statements)

References 31 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We established a protein-protein interaction (PPI) network consisting of 165 nodes and 170 edges and identified 18 hub genes by MCODE plugin in Cytoscape. The 18 hub genes have been reported to be associated with gastric cancer, which are CCND2 [27] STAT3 [28], TP53 [29], MCL1 [30], MYC [31], FOXO1 [32], FOXO3 [33], BCL2L11 [34], GSK3B [35], CDKN1A [36], CDH1 [37], PTEN [38], MTOR [39], MAPK1 [40], CASP3, CDC42[41], SMAD4 [42] and IL6 [43]. All of them were predicted target genes for hsa-miR-197-3p, hsa-miR-451a, hsa-miR-136-5p, hsa-miR-337-3p, hsa-miR-654-3p, hsa-miR-182-5p, hsa-miR-1228-3p, hsa-miR-942-5p, hsa-miR-488-3p and hsa-miR-876-3p, and all these 10 miRNAs were predicted miRNAs for hsa_circ_0001013.…”

Section: Discussionmentioning

confidence: 99%

Construction of a circRNA-miRNA-mRNA network based on differentially co-expressed circular RNA in gastric cancer tissue and plasma by bioinformatics analysis

Gong¹,

Qi²,

Fu³

et al. 2020

Preprint

View full text Add to dashboard Cite

Background: Increasing evidence implicates circular RNAs (circRNAs) have been involved in human cancer progression. However, the mechanism remains unclear. In this study, we identified novel circRNAs related to gastric cancer and constructed a circRNA-miRNA-mRNA network.Methods: Microarray dataset GSE83521 and GSE93541 were obtained from Gene Expression Omnibus (GEO). Then, we used computational biology to select differentially co-expressed circRNAs in GC tissue and plasma and detected the expression of selected circRNAs in gastric cell lines by quantitative real‑time polymerase chain reaction (qRT‑PCR). We also chose the candidate miRNAs and their target genes for circRNAs through online tools. Combining the predictions of miRNAs and target mRNAs, a competing endogenous RNA regulatory network was established. Functional and pathway enrichment analyses were performed, and interactions between proteins were predicted by using String and Cytoscape. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses were performed to elucidate the possible functions of these differentially expressed circRNAs.Results: The regulatory network constructed using the microarray datasets (GSE83521 and GSE93541) contained three differentially co-expressed circRNAs (DECs). A circRNA-miRNA-mRNA network was constructed based on 3 circRNAs, 43 miRNAs and 119 mRNAs. GO and KEGG analysis showed that regulation of apoptotic signaling pathway and PI3K−Akt signaling pathway were highest degrees of enrichment respectively. We established a protein-protein interaction (PPI) network consisting of 165 nodes and 170 edges and identified hub genes by MCODE plugin in Cytoscape. Furthermore, a core circRNA-miRNA-mRNA network was constructed base on hub genes. Hsa_circ_0001013 was finally determined to play an important role in the pathogenesis of GC according to the core circRNA-miRNA-mRNA network.Conclusions: We propose a new circRNA-miRNA-mRNA network associated with the pathogenesis of GC. The network may become a new molecular biomarker and be used to develop potential therapeutic strategies for gastric cancer.

show abstract

Section: Discussionmentioning

confidence: 99%

Construction of a circRNA-miRNA-mRNA network based on differentially co-expressed circular RNA in gastric cancer tissue and plasma by bioinformatics analysis

Gong¹,

Qi²,

Fu³

et al. 2020

Preprint

View full text Add to dashboard Cite

show abstract

“…8 SHP-1 was also reported to be ubiquitinated and degraded into 26S proteasome, and the ubiquitin ligase RNF6 could activate STAT3 signaling by modulating SHP-1 ubiquitination in gastric cancer and colorectal cancer. 9,10 In the current study, ellagic acid (EA) was found to exert its antitumor activity by suppressing STAT3 in ESCC cells. In mechanism, EA could inhibit the expression of RNF6 and then stabilize SHP-1 in ESCC cells.…”

Section: Introductionmentioning

confidence: 85%

Ellagic acid induces esophageal squamous cell carcinoma cell apoptosis by modulating SHP‐1/STAT3 signaling

Wang

Huang

et al. 2020

The Kaohsiung J of Med Scie

View full text Add to dashboard Cite

Ellagic acid (EA) has been reported to have antiproliferative and antioxidant properties, but its function in esophageal squamous cell carcinoma (ESCC) has not been investigated yet. In the current study, EA was found have a significant anti‐tumor activity in ESCC. In specific, EA inhibited ESCC cell survival in both of a concentration‐ and time‐dependent manner. And our results showed that EA promoted ESCC cell apoptosis, including inducing the cleavages of PARP, and inhibiting the expression of anti‐apoptotic proteins. In mechanistic, EA markedly suppressed STAT3‐driven luciferase activity, and inhibited both of the endogenous and cytokines‐induced STAT3 activation in ESCC cells. Further investigations indicated that EA could significantly upregulate SHP‐1 expression, a negative modulator of STAT3 signaling. In contrast, knockdown of SHP‐1 could attenuate the effects of EA on inhibiting ESCC cell survival. Moreover, we found that EA could inhibit RNF6 expression, an E3 of SHP‐1, and overexpressing RNF6 could also significantly attenuate the effects of EA on inhibiting ESCC cell survival, which further revealed that EA could inhibit STAT3 signaling by modulating RNF6/SHP‐1 axis. Our present study indicated that EA could be as a novel STAT3 inhibitor for the treatment of ESCC.

show abstract

“…The human USP44 gene was generated and cloned into pcDNA3.1 vector with a Myc tag as previously described . The primers used for gene amplification were as follows: USP44, forward 5′‐ ATGCTAGCAATGGATACGTGCAAAC ‐3′, reverse 5′‐ TCAGCTAAGGATTTCATTAGACGAG −3′.…”

Section: Methodsmentioning

confidence: 99%

“…The human USP44 gene was generated and cloned into pcDNA3.1 vector with a Myc tag as previously described. 17 The primers used for gene amplification were as follows: USP44, forward 5 0 -ATGCTA GCAATGGATACGTGCAAAC -3 0 , reverse 5 0 -TCAGCTAAGGATTTCA TTAGACGAG −3 0 . Plasmids were transiently transfected into NSCLC or HEK293T cells by Lipofectamine 2000 (Invitrogen) according to the manufacturer's instruction.…”

Section: Plasmids Construction and Gene Transfectionmentioning

confidence: 99%

Ubiquitin‐specific protease 44 inhibits cell growth by suppressing AKT signaling in non‐small cell lung cancer

Zhang

Wang

Zhang

et al. 2019

The Kaohsiung J of Med Scie

View full text Add to dashboard Cite

Ubiquitin‐specific protease 44 (USP44) has been reported as a tumor suppressor or promoter in some tumors, but its function in non‐small cell lung cancer (NSCLC) is still unclear. In this study, USP44 was found significantly downregulated in both of NSCLC tissues and cell lines, and low expression of USP44 predicted a poor prognosis for NSCLC patients. Overexpression of USP44 markedly downregulated the expression levels of Cyclin D1 and CDK4, but upregulated p53 expression, as a result of which, suppressing the cell growth of NSCLC cells. Further studies indicated that overexpression of USP44 significantly inhibited the phosphorylation of AKT, and its down‐stream signals, including mTOR and P70S6K. Moreover, overexpression of USP44 increased PTEN protein but not its mRNA levels, which suggested that USP44 inhibited AKT signaling by stabilizing PTEN in NSCLC cells. In conclusion, we demonstrated that USP44 showed prior evidence of a tumor suppressive function in NSCLC cells, and inhibited NSCLC cell growth by suppressing AKT signaling, suggesting that USP44 could be as a novel target for NSCLC therapy.

show abstract

Knockdown of RNF6 inhibits gastric cancer cell growth by suppressing STAT3 signaling

Cited by 30 publications

References 31 publications

Construction of a circRNA-miRNA-mRNA network based on differentially co-expressed circular RNA in gastric cancer tissue and plasma by bioinformatics analysis

Construction of a circRNA-miRNA-mRNA network based on differentially co-expressed circular RNA in gastric cancer tissue and plasma by bioinformatics analysis

Ellagic acid induces esophageal squamous cell carcinoma cell apoptosis by modulating SHP‐1/STAT3 signaling

Ubiquitin‐specific protease 44 inhibits cell growth by suppressing AKT signaling in non‐small cell lung cancer

Contact Info

Product

Resources

About