Knuckle pads, in an epidermal palmoplantar keratoderma patient with Keratin 9 R163W transgrediens expression

Analysis of the KRT9 Gene in a Mexican Family with Epidermolytic Palmoplantar Keratoderma

“…Genomic DNA was extracted from leukocytes of affected and healthy members of the EPPK family as described elsewhere . Taking into account that nearly all KRT9 mutations in EPPK are found in the 1A helix initiation motif domain region and that R163W mutation is present in EPPK with knuckle pads , we analyzed exon 1 of the KRT9 gene with the following primers (based on http://www.genatlas.org): forward 5′ GACCAAGACAGAGACAGTTTC and reverse 5′ CTCCTATCACTGCTTCTCAAC. Polymerase chain reaction (PCR) conditions were initial denaturation at 94°C for 5 minutes and 25 cycles consisting of 94°C for 1 minute, 58°C for 1.5 minutes, 72°C for 2 minutes, and a final extension at 72°C for 2 minutes.…”

A recurrent p.M157R mutation of keratin 9 gene in a Chinese family with epidermolytic palmoplantar keratoderma and literature review

“…Keratins are a group of proteins that form the intermediate filament cytoskeleton of epithelial cells, which are important for structural integrity . Structurally all keratins consist of a central α‐helical rod domain of 310 amino acids flanked by non‐helical head (V1) and tail (V2) domains, and the rod domain is divided into the 1A, 1B, 2A, and 2B domains . The beginning of the 1A rod domain and the end of the 2B rod domain of the KRT9 are the “hotspots” for mutations .…”

Case of epidermolytic palmoplantar keratoderma with knuckle pads

“…We have summarized the cases of EPPK with knuckle pads and documented KRT 9 mutations (Table 1). 7–12 All of these mutations are located in the HIM region, and no correlation with ethnicity has been seen. Although the R163Q mutation of KRT 9 in our case is a recurrent mutation, 2 this is the first case of this mutation with knuckle pads in EPPK.…”

“…Mutant K9 weakens the cytoskeleton and excessive hyperkeratosis occurs in response to mechanical friction 5,6 . Knuckle pads or knuckle pad‐like keratosis may be seen in some patients with EPPK 7–12 . Though mechanical friction and/or a KRT 9 mutation are suggested as its cause, its pathogenesis remains uncertain.…”

“…Codispoti et al. 12 revealed that the amount of K9 mRNA expression in the knuckle pads of an EPPK patient was elevated approximately 90‐fold compared with that in non‐EPPK individuals and suggested the ectopic expression of K9 in the proximal interphalangeal and metacarpophalangeal joints. Our patient had keratotic erythema around the knuckle pads and on the distal dorsal aspect of the fingers.…”