Ku80 as a Novel Receptor for Thymosin β4 That Mediates Its Intracellular Activity Different from G-actin Sequestering

Abstract

Our data demonstrate that increased intracellular expression of thymosin ␤4 (T␤4) is necessary and sufficient to induce plasminogen activator inhibitor type 1 (PAI-1) gene expression in endothelial cells. To describe the mechanism of this effect, we produced T␤4 mutants with impaired functional motifs and tested their intracellular location and activity. Cytoplasmic distributions of T␤4 (AcSDKPT/4A) , T␤4 (KLKKTET/7A) , and T␤4 (K16A) mutants fused with green fluorescent protein did not differ significantly from those of wild-type T␤4. Overexpression of T␤4, T␤4 (AcSDKPT/4A) , and T␤4 (K16A) affected intracellular formation of actin filaments. As expected, T␤4 (K16A) uptake by nuclei was impaired. On the other hand, overexpression of T␤4 (KLKKTET/7A) resulted in developing the actin filament network typical of adhering cells, indicating that the mutant lacked the actin binding site. The mechanism by which intracellular T␤4 induced the PAI-1 gene did not depend upon the N-terminal tetrapeptide AcSDKP and depended only partially on its ability to bind G-actin or enter the nucleus. Both T␤4 and T␤4 (AcSDKPT/4A) induced the PAI-1 gene to the same extent, whereas mutants T␤4 (KLKKTET/7A) and T␤4 (K16A) retained about 60% of the original activity. By proteomic analysis, the Ku80 subunit of ATPdependent DNA helicase II was found to be associated with T␤4. Ku80 and T␤4 consistently co-immunoprecipitated in a complex from endothelial cells. Co-transfection of endothelial cells with the Ku80 deletion mutants and T␤4 showed that the C-terminal arm domain of Ku80 is directly involved in this interaction. Furthermore, down-regulation of Ku80 by specific short interference RNA resulted in dramatic reduction in PAI-1 expression at the level of both mRNA and protein synthesis. These data suggest that Ku80 functions as a novel receptor for T␤4 and mediates its intracellular activity.2 is the most abundant member of the highly conserved family of acidic polypeptides called ␤-thymosins. Although it is a typical intracellular polypeptide, it plays numerous roles, both intracellularly and extracellularly. Numerous observations indicate that T␤4 is involved in adhesion and spreading of fibroblasts (1, 2), differentiation of endothelial cells (3, 4), directional migration of endothelial cells and keratinocytes (5-8), angiogenesis (3-6, 9, 10), wound healing (6, 7, 11), hair follicle growth (8), and apoptosis (12, 13), and has been described to possess anti-inflammatory properties (11,14). In addition, elevated T␤4 expression has been observed in various malignant cell lines and tumors (15-17) and its levels seem to be associated with increased tumorigenicity and metastatic potential (10, 13, 18 -20). The increased expression of T␤4 correlates with the invasive capability of the cells, the degree of morphologic transformation, and disintegration of actin filaments (21). Recent studies have also correlated increased T␤4 expression with potentiated cell growth (13, 22) but this observation seems not to be universal (2, 10).T␤4 is conside...

Thymosin β4 induces proliferation, invasion, and epithelial-to-mesenchymal transition of oral squamous cell carcinoma

“…Tβ4 interacts with hMLH1 in colon cancer (Brieger et al 2007), and Ku80 is related in signaling initiated by Tβ4 that leads to activation of PAI-1 gene expression (Bednarek et al 2008). Also, Tβ4 interacts with the cytoplasmic domain of stabilin-2 and overexpression of Tβ4 increased the phagocytic activity of stabilin-2 (Lee et al 2008).…”

Curcuma Oil Reduces Endothelial Cell-mediated Inflammation in Postmyocardial Ischemia/Reperfusion in Rats

“…IAEC/2012/60). EA.hy926 endothelial cells generated by C. J. S. Edgell (was generously provided as a gift from the University of North Carolina, Lineberger Comprehensive Cancer Centre) 18,19 and human monocytic cell line (THP-1) cells from patients with acute monocytic leukemia were cultured in DMEM and RPMI-1640 (Himedia), respectively supplemented with 10% FBS and 1% penicillin/streptomycin. C. longa rhizomes were procured from the market, and their authenticity was established with the specimen from CSIR-CDRI, Botany division specimen voucher Accession No.…”

MRTF-A controls vessel growth and maturation by increasing the expression of CCN1 and CCN2

“…In vitro tube formation and coculture experiments. For matrigel experiments, HMECs were transfected with pcDNA, MRTF-A, T 4±MRTF-shRNA (5 0 -GATC CCCGCATGGAGCTGGTGGAGAAGAATTCAAGAGATTCTTCTCCACCAG CTCCATGTTTTTGGAAA-3 0 ), T 4 m (which lacked the G-actin-binding motif KLKKTET) 41 or T 4±CCN1-shRNA. Cells (8,000 cells per well) were seeded on matrigel (BD Matrigel Basement Membrane Matrix, BD Biosciences, USA) in basal endothelial growth medium with an 5% fetal bovine serum addition and pictures were taken after 18 h. Number of rings per low-power field was quantified.…”