L-fucose reduces gut inflammation due to T-regulatory response in Muc2 null mice

Abstract

Fucose, the terminal glycan of the intestinal glycoprotein Mucin2, was shown to have an anti-inflammatory effect in mouse colitis models and modulate immune response due to macrophage polarization changes. In this study we evaluated the effect of 0.05% L-fucose supplementation of drinking water on immune parameters in the intestine of homozygous mutant Muc2−/−, compared to Muc2+/+ mice. To get into innate and adaptive immunity mechanisms of gut inflammation, we tested PrkdcSCIDMuc2−/− strain, Muc2 knockout on SCID background, that is characterized by lack of lymphocytes, in comparison with PrkdcSCID mice. We evaluated intestinal cytokine profiling, macrophage and eosinophil infiltration, and expression of Nos2 and Arg1 markers of macrophage activation in all strains. Markers of Th1, Treg and Th17 cells (Tbx21, Foxp3, and Rorc expression) were evaluated in Muc2−/− and Muc2+/+ mice. Both Muc2−/− and PrkdcSCIDMuc2−/− mice demonstrated increased numbers of macrophages, eosinophils, elevated levels of TNFa, GM-CSF, and IL-10 cytokines. In Muc2−/− mice we observed a wide range of pro-inflammatory cytokines elevated, such as IFN-gamma, IL-1b, IL-12p70, IL-6, M-CSF, G-CSF, IL-17, MCP-1, RANTES, MIP1b, MIP2. Muc2−/− mice demonstrated increase of Nos2, Tbx21 and Foxp3 genes mRNA, while in PrkdcSCIDMuc2−/− mice Arg1 expression was increased. We found that in Muc2−/− mice L-fucose reduced macrophage infiltration and IL-1a, TNFa, IFNgamma, IL-6, MCP-1, RANTES, MIP1b levels, decreased Nos2 expression, and induced the expression of Treg marker Foxp3 gene. On the contrary, in PrkdcSCIDMuc2−/− mice L-fucose had no effect on macrophage and eosinophil numbers, but increased TNFa, GM-CSF, IL-12p70, IL-6, IL-15, IL-10, MCP1, G-CSF, IL-3 levels and Nos2 gene expression, and decreased Arg1 gene expression. We demonstrated that anti-inflammatory effect of L-fucose observed in Muc2−/− mice is not reproduced in PrkdcSCIDMuc2−/−, which lack lymphocytes. We conclude that activation of Treg cells is a key event that leads to resolution of inflammation upon L-fucose supplementation in Muc2−/− mice.

Antitumor Effects of an Anthocyanin-Rich Grain Diet in a Mouse Model of Lewis Lung Carcinoma

“…We measured Nos2 expression as a marker of the pro-inflammatory M1 and Arg1 expression as a marker of the M2 subpopulation of macrophages as well as the expression of the Becn1 gene encoding autophagy-related protein Beclin1 in the tumor tissue. The mRNA levels of the target and reference genes were measured by qPCR according to a previously published protocol [ 56 ]. The gene expression was normalized to the Tubb5 ( tubulin , beta 5 class I ) mRNA level as ΔCt = 2 ^ (Ct Tubb5 mRNA − Ct gene of interest mRNA).…”

“…The gene expression was normalized to the Tubb5 ( tubulin , beta 5 class I ) mRNA level as ΔCt = 2 ^ (Ct Tubb5 mRNA − Ct gene of interest mRNA). All the primer sequences were designed by our team using the Primer-BLAST ( accessed on 1 May 2020) [ 57 ] and Unipro UGENE version 1.32 [ 58 ] programs and published previously [ 56 , 59 ]. The following primer sequences were used for the real-time PCR analysis: Tubb5 _F: TGAAGCCACAGGTGGCAAGTAT, Tubb5 _R: CCAGACTGACCGAAAACGAAGT; Arg1 _F: AAGAGCTGGCTGGTGTGGTG, Arg1 _R: ACACAGGTTGCCCATGCAGA; Nos2 _F: ATCGACCCGTCCACAGTATGT, Nos2 _R: CATGATGGACCCCAAGCAAGA; Becn1 _F: GAACTCACAGCTCCATTACTTA, Becn1 _R: ATCTTCGAGAGACACCATCC.…”

Effect L-fucose on the metabolism of peritoneal macrophages of Muc2 −/− mice in vitro

“…For peritoneal macrophage isolation, animals were euthanized by decapitation at the age of 12 weeks, when they have histological signs of IBD, shown in previous works 57 . Next, skin of the abdominal region was removed and 5 mL of sterile ice-cold PBS were injected into the peritoneal cavity.…”

The role of the glycome in symbiotic host-microbe interactions

“…L-fucose treatment ameliorates DSS-induced colonic inflammation and intestinal epithelial injury via accelerating the proliferation of intestinal stem cells ( Tan et al 2022 ). L-fucose supplementation also activates Treg cells thus contributing to the resolution of intestinal inflammation ( Feofanova et al 2022 ).…”