Legacy of draught cattle breeds of South India: Insights into population structure, genetic admixture and maternal origin

Abstract

The present study is the first comprehensive report on diversity, population structure, genetic admixture and mitochondrial DNA variation in South Indian draught type zebu cattle. The diversity of South Indian cattle was moderately higher. A significantly strong negative correlation coefficient of −0.674 (P<0.05) was observed between the effective population size of different breeds and their estimated FIS. The phylogeny and genetic structure analysis revealed the distinctness of Kangayam, Vechur and Punganur cattle from the rest of the zebu breeds. The results showed the influence of Hallikar breed in the development of most Mysore type cattle breeds of South India with the exception of Kangayam. Bayesian clustering analysis was performed to assess the taurine admixture in South Indian zebu cattle using purebred Jersey and Holstein-Friesian as reference genotypes. Relatively high levels of taurine admixture (>6.25%) was observed in Punganur, Vechur, Umblachery and Pulikulam cattle breeds. Two major maternal haplogroups, I1 and I2, typical of zebu cattle were observed, with the former being predominant than the later. The pairwise differences among the I2 haplotypes of South Indian cattle were relatively higher than West Indian (Indus valley site) zebu cattle. The results indicated the need for additional sampling and comprehensive analysis of mtDNA control region variations to unravel the probable location of origin and domestication of I2 zebu lineage. The present study also revealed major concerns on South Indian zebu cattle (i) risk of endangerment due to small effective population size and high rate of inbreeding (ii) lack of sufficient purebred zebu bulls for breeding and (iii) increasing level of taurine admixture in zebu cattle. Availability of purebred semen for artificial insemination, incorporation of genomic/molecular information to identify purebred animals and increased awareness among farmers will help to maintain breed purity, conserve and improve these important draught cattle germplasms of South India.

Indigenous cattle of Sri Lanka: Genetic and phylogeographic relationship with Zebu of Indus valley and South Indian origin

“…Samples from Red Sindhi, Tharparkar and Sahiwal were collected from Indus Valley regions located in Pakistan. Additionally, short tandem repeat genotype and sequence data on two South Indian breeds, Hallikar (36) and Kangayam (51) generated in a previous study (Manomohan et al, 2021) was included for comparative analysis. A map indicating the sampling locations of Sri Lankan zebu cattle is provided in Figure 1.…”

“…27 FAO recommended microsatellite markers (FAO, 2011) with forward primers conjugated to one of the three fluorescent dyes (FAM, HEX and ATTO550) were used for genotyping. The details of microsatellite markers, dye conjugated, annealing temperature, allele size range and PCR (Manomohan et al, 2021). The PCR products were capillary electrophoresed after multiplexing in an automated DNA analyzer ABI3100 (Applied Biosystems, USA) with ROX500 (Applied Biosystems, USA) as an internal lane control.…”

“…The mitochondrial D-Loop region was amplified using the primers BTMTD1-F (5' AGGACAACCAGTCGAACACC 3') and BTMTD1-R 5' (GTGCCTTGCTTTGGGTTAAG 3') reported by Manomohan et al, (2021). The amplicon included complete D-loop (control region) flanked by partial cytochrome B, complete t-RNA-Thr and complete t-RNA-Pro coding sequences at 5' end while partial t-RNA-Phe sequence flanked the 3'end.…”

“…Additionally, 87 mtDNA sequences from two South Indian cattle breeds, Hallikar (NCBI-GenBank accessions MW319954-MW319988; MW320341) and Kangayam (NCBI-GenBank accessions MW319989-MW320038; MW320342) were included for comparative analysis (Manomohan et al, 2021). Mitochondrial DNA diversity parameters including number of polymorphic, singleton and parsimony informative sites, nucleotide diversity, haplotype diversity and average number of nucleotide differences were calculated using DnaSP, version 4.10 (Rozas, 2009).…”

Novel Populations from Simulated Admixed Populations

“…Mixing of populations resulting in genetic admixtures is an important process in evolution [1] as it is one of the fastest evolutionary processes to affect the genetic structure of a population [2] and have been observed in many species; including, human [3], fish [4], cat [5], cattle [6], and moth [7]. This can lead to a rapid genetic diversification, which may result in rapid reduction of detrimental mutation load [8], improved health [9,10], and disease resistance [11].…”