Lesch-Nyhan Syndrome: Models, Theories, and Therapies

Bell, Scott C.; Kolobova, Ilaria; Crapper, Liam; Ernst, Carl

doi:10.1159/000449296

Cited by 58 publications

(44 citation statements)

References 97 publications

(109 reference statements)

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Mutations in the HPRT1 gene can cause severe neurological and metabolic disorders in humans (Fu et al 2014, Harris 2018. It has been shown that mice carrying a defective gene, as a rule, lack bright phenotypic manifestations (Bell et al 2016). However, during the creation of genetically modified animals with a deletion of the nucleotide triplet, which causes the absence of valine in the eighth position of the amino acid sequence of the protein, we encountered certain difficulties.…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

New personalized genetic mouse model of Lesch-Nyhan syndrome for pharmacology and gene therapy

Kalmykov¹,

Kusov²,

Yablonskaia³

et al. 2018

RRP

View full text Add to dashboard Cite

Citation: Kalmykov VA, Kusov PA, Yablonskaia MI, Korshunov EN, Korshunova DS, Kubekina MV, Silaeva YYu, Deykin AV, Lukyanov NE (2018) New personalized genetic mouse model of Lesch-Nyhan syndrome for pharmacology and gene therapy. AbstractIntroduction: Lesch-Nyhan syndrome is a clinical and laboratory disorder caused by X-linked disruption of the purine metabolism. The deletion in the HPRT1 gene leads to the disappearance of valine in the eighth position of the protein amino acid sequence. The disease occurs in males and is accompanied by an excess of uric acid, urate nephropathy and neurologic impairment. Objective of the Study:Generation of the new personalized genetic mouse model of Lesch-Nyhan syndrome for preclinical study of new approaches to the pharmacological and gene therapy Materials and Methods: For genomic editing, the sequence was synthesized the sequence of the matrix GACCG-GTCCCGTCATGCCGACACGCAGTCCCAGCGTGGTGAGCCAAGGGGACTCCAGCAGAGCCCCACAG was synthesized. For the cultivation of viable mouse embryos after microinjection, KSOM media was used. Amplification and sequencing was performed by the standard methods. Results:A boy with not previously described hemizygous variant in the HPRT1 gene, was observed in our clinic. The mutation was the deletion of 8Val in the first exon of the HPRT1 gene. To introduce this mutation, we used the CRIS-PR-Cas9 genomic editing system. The genetic construct for microinjections included a mixture of the vector for the expression of Cas9 and sgRNA (px330), as well as the matrix for homologous recombination (ssODN), in a ratio of 1 part Cas9 to 3 parts of the ssODN matrix. Four of the 12 obtained animals were mosaic transgenes. One of 4 mice mated with a male from the hybrid strain CBA x C57BL/6, and descendants of F 2 have already been received from this mating. Discussion:During the creation of HPRT1 genetically modified mice, we encountered certain difficulties. First, from 615 transplanted embryos, only 12 were able to complete full embryonic development. 9 recipients we observed abortions in the later stages. These data may indicate possible violations of embryonic development in animals carrying a mutant copy of the HPRT1 gene. Conclusion:In the current study, we present the results of the generation of a genetically modified mouse strain carrying a deletion in the HPRT1 gene. These mice can be effectively used for the preclinical testing of new drugs aimed at the treatment of Lesch-Nyhan syndrome.

show abstract

Section: Discussionmentioning

confidence: 99%

“…Despite the fact that Hprt1-deficient mice models do not have a clinical complex characteristic of patients with Lesch-Nyhan syndrome, these models should be used in studies of brain metabolism (Bell et al 2016) and precli-nical studies of the effectiveness of new treatments for this disease, particularly of gene therapy.…”

Section: Introductionmentioning

confidence: 99%

New personalized genetic mouse model of Lesch-Nyhan syndrome for pharmacology and gene therapy

Kalmykov¹,

Kusov²,

Yablonskaia³

et al. 2018

RRP

View full text Add to dashboard Cite

show abstract

“…Sometimes, the selective removal of teeth is performed reluctantly. 3 Treatments with deep brain stimulation 17 and S-Adenylmethionine 18 has been reported, and these are promising methods for treating self-mutilating behavior associated with LNS. Additionally, pharmacologic approaches to therapy based on the neurotransmitter imbalance and gene therapy have not yet been successful in vivo, but this is a promising direction.…”

Section: Lns Can Be One Of the Causes Of Delayed Development In Childmentioning

confidence: 99%

Lesch-nyhan syndrome, a disease that could be easily missed: case series

Ko¹,

Sung²,

Lee³

et al. 2018

IPMRJ

View full text Add to dashboard Cite

Purpose: Lesch-Nyhan syndrome (LNS) is an X-linked recessive disorder of purine metabolism with a defect in the activity of hypoxanthine-guanine phosphoribosyl transferase (HPRT). The aim of this study was to describe 2 cases of LNS, who were very difficult to be diagnosed. Methods: Two cases of LNS were described: 6-month-old and 13-month-old children with delayed development, increased muscle tone, and kidney problem (hydronephrosis and nephrocalcinosis respectively). Results: Diagnosis of LNS can be missed because 1) it is a very rare disease, 2) the usual laboratory serum uric acid level is based on adult men, not children, 3)some patients may only have hyperuricosuria, not hyperuricemia 4) clinical manifestations of LNS vary at different ages, 5) neuroimaging cannot help diagnose LNS, and 6) normal result of HPRT1 gene cannot rule out the diagnosis of LNS, and an analysis of HPRT activity is further needed in this case. Conclusion: Urine uric acid/creatinine ratio should be checked in children with delayed development, with consideration for the above findings.

show abstract

“…Ведущая симптоматика при синдроме Леша-Нихана связана с неврологической патологией (церебральный паралич, нарушение речи, умственная отсталость), однако развитие подагры и повышенная концентрация мочевой кислоты в моче приводит к МКБ с образованием уратных камней [8,41]. При синдроме Леша-Нихана для уменьшения неврологической симптоматики назначают препараты S-аденилметионина, снижающие уровень трансаминаз, для предотвращения образования уратных камней -обильное питьё и диета, направленные на повышение рН мочи [42,43].…”

Section: синдром леша-ниханаunclassified

Genetic and biochemical features of the monogenic hereditary urolithiasis

Mikhaylenko

Prosyannikov²,

Baranova

et al. 2018

BIOMED KHIM

View full text Add to dashboard Cite

Urolithiasis is a common urological problem. In most cases, this multifactorial pathology develops due to the combination of inherited low-penetrance gene variants and environment factors such as urinary tract infections and unbalanced diet. However, some cases are monogenic. These hereditary forms of urolithiasis manifest in childhood, and are characterized by multiple, bilateral and recurrent kidney stones and progress to chronic renal failure relatively early. Due to widening acceptance of exome and gene panel sequencing, substantially larger percentages of urolithiasis cases are now attributed to hereditary causes, up to 20% among patients of 18 years old or younger. Here we review genetic and biochemical mechanisms of urolithiasis, with an emphasis on its hereditary forms, including fermentopathies (primary hyperoxaluria, adenine phosphorobosyltransferase deficiency, phosphoribosyl-pyrophosphate-synthetase deficiency, xanthinuria, Lesch-Nihan syndrome) and these caused by membrane transport alterations (Dent's disease, familial hypomagnesia with hypercalciuria and nephrocalcinosis, hypophosphatemic urolithiasis, distal tubular acidosis, cystinuria, Bartter's syndrome). We suggest a comprehensive gene panel for NGS diagnostics of the hereditary urolithiasis. It is expected that accurate and timely diagnosis of hereditary forms of urolithiasis would enable the counselling of the carriers in affected families, and ensure personalized management of the patients with these conditions.

show abstract

Lesch-Nyhan Syndrome: Models, Theories, and Therapies

Cited by 58 publications

References 97 publications

New personalized genetic mouse model of Lesch-Nyhan syndrome for pharmacology and gene therapy

New personalized genetic mouse model of Lesch-Nyhan syndrome for pharmacology and gene therapy

Lesch-nyhan syndrome, a disease that could be easily missed: case series

Genetic and biochemical features of the monogenic hereditary urolithiasis

Contact Info

Product

Resources

About