Linezolid‐resistant MRSA‐CC398 carrying the cfr gene, and MRSA‐CC9 isolates from pigs with signs of infection in Spain

Abstract

Aims: To perform the molecular characterization of 23 Staphylococcus aureus isolates from pigs with signs of infections recovered in Spanish farms during 2018-2019. Methods and Results: The antimicrobial resistance pattern and virulence profile were determined. The molecular typing was performed by different molecular techniques. The transferability of the cfr gene was assessed by conjugation and its genetic environment was determined by PCR mapping. In all, 21 isolates were methicillin-resistant S. aureus (MRSA) carrying the mecA gene (SCCmecV or non-typeable SCCmec), whereas the remaining two were methicillin-susceptible (MSSA). All but one MRSA isolates (n = 20) belonged to the CC398, being the spa t011 the most prevalent (n = 11). The remaining MRSA and the two MSSA isolates were ascribed to ST9/CC9. The S. aureus isolates exhibited resistance to (number of resistant isolates): b-lactamics (21), erythromycin and/or clindamycin (20), aminoglycosides (7), tetracycline (22), fluoroquinolones (14), chloramphenicol (5) and linezolid (1). The S. aureus isolates did not carry any of the virulence genes studied. One MRSA belonging to the CC398 showed linezolid resistance mediated by the cfr gene. The cfr gene was co-located with fexA in the Tn558 variant previously reported in the S. aureus plasmid pSCFS7. Conclusions: Two major livestock-associated genetic lineages were detected among pigs with signs of infection in Spain. The presence of the cfr gene among LA-MRSA-CC398 is of great concern not only for veterinary medicine, but also for humans in close contact. Significance and Impact of the Study: This work describes the molecular characterization of S. aureus isolates recovered from pigs with signs of infection and we report, as far as we know, the first description of MRSA-CC9 from pigs in Spain. Moreover, the detection of a MRSA-CC398 isolate carrying the multiresistance cfr gene highlights the need for continuous surveillance and awareness of LA-MRSA.

Emergence of Cfr-Mediated Linezolid Resistance among Livestock-Associated Methicillin-Resistant Staphylococcus aureus (LA-MRSA) from Healthy Pigs in Portugal

“…Previous studies reported the presence of MRSA from ST398 with the same spa -type observed in pigs, in humans in close contact with pig farms [ 3 , 11 , 20 ]. The emergence of cfr -mediated linezolid resistance in MRSA from animal origin has also been reported in horses in Germany [ 26 ], pigs in Belgium [ 27 ], Korea [ 28 ], China [ 29 ], and Spain [ 30 ], and poultry in China [ 29 ]. Moreover, cfr -positive MRSA strains have been reported sporadically in humans in several European countries, including Italy [ 31 ], Portugal [ 14 ], Spain [ 32 ], as well in hospital outbreaks in Spain [ 33 ] and China [ 34 ].…”

Development of a novel core genome MLST scheme for tracing multidrug resistant Staphylococcus capitis

“…Filter mating experiments were performed to investigate whether the cfr carrying plasmid is conjugative. Using a clinical isolate S. aureus 719 (ST5, cfr negative) and ATCC29213-rifR as recipients and S. capitis LZD1 and LZD8 as donors with selection on nutrient agar plates containing 4 mg L −1 linezolid and 12.5 mg L −1 tetracycline or plates containing 4 mg L −1 linezolid and 50 mg L −1 rifampin according to the reference with adjustment in antibiotic concentrations 49 , 50 . The transconjugants were identified using MALDI-TOF and PCR of cfr gene with primers ( cfr -fw: TGAAGTATAAAGCAGGTTGGGAGTCA; cfr -rv: ACCATATAATTGACCACAAGCAGC) 51 .…”

Role played by the environment in the emergence and spread of antimicrobial resistance (AMR) through the food chain

“…These include ESBLs or fluoroquinolone resistance in Enterobacterales and/or Campylobacter in poultry and dairy production or LA‐MRSA in pigs. Some studies have also searched databases, or conducted limited field studies for newly emerging resistances that have been initially reported in animal production outside the EU, such as carbapenem and mcr ‐related transferable colistin ARGs (Bennani et al., 2020; Irrgang et al., 2020; Caffrey et al., 2021; Jochum et al., 2021; Ruiz‐Ripa et al., 2021). Less well‐researched or readily culturable organisms, such as C. difficile , may however also be relevant (Heise et al., 2021).…”