LncRNA SNHG16 Drives Proliferation and Invasion of Papillary Thyroid Cancer Through Modulation of miR-497 [Retraction]

The correlation of lncRNA SNHG16 with inflammatory cytokines, adhesion molecules, disease severity, and prognosis in acute ischemic stroke patients

“…The relative expression of lncRNA SNHG16 was calculated by the 2 −ΔΔCt method where glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) served as an internal reference. The detailed sequences of primers were in line with those of a previous study and displayed as follows: lncRNA SNHG16, forward, 5′‐TGTTCGTCATGGGTGTGAAC‐3′, reverse, 5′‐ATGGCATGGACTGTGGTCAT‐3′; GAPDH, forward, 5′‐AAGGTGAAGGTCGGAGTCAA‐3′, reverse, 5′‐AATGAAGGGGTCATTGATGG‐3′ 15 . Besides, serum was isolated from PB of AIS patients to detect the levels of inflammatory cytokines (TNF‐α, IL‐1β, IL‐6, and IL‐10), and adhesion molecules (intercellular cell adhesion molecule‐1 (ICAM‐1) and vascular cell adhesion molecule‐1 (VCAM‐1)) by enzyme‐linked immunosorbent assay (ELISA) using commercial Human ELISA Kits (Bio‐Techne China Co., Ltd.).…”

“…The detailed sequences of primers were in line with those of a previous study and displayed as follows: lncRNA SNHG16, forward, 5′-TGTTCGTCATGGGTGTGAAC-3′, reverse, 5′-ATGGCATGGACTGTGGTCAT-3′; GAPDH, forward, 5′-AAGGTGAAGGTCGGAGTCAA-3′, reverse, 5′-AATGAAGGGGTCA TTGATGG-3′. 15 Besides, serum was isolated from PB of AIS patients to detect the levels of inflammatory cytokines (TNFα, IL-1β, IL-6, and IL-10), and adhesion molecules (intercellular cell adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule-1 (VCAM-1)) by enzyme-linked immunosorbent assay (ELISA) using commercial Human ELISA Kits (Bio-Techne China Co., Ltd.). The experimental process was in stringent accordance with the instructions from the manufacturer.…”

Relationship between M6A methylation regulator and prognosis in patients with hepatocellular carcinoma after transcatheter arterial chemoembolization

“…Except for TSPEAR-AS2, which was not controlled, we discovered that six lncRNAs (HCG18, LINC01703, NUTM2A-AS1, SNHG16, TSPEAR-AS2, and THUMPD3-AS1) were considerably up-regulated in hepatocellular carcinoma. Other investigations have discovered that HCG18 stimulates hepatocellular carcinoma advancement through the miR-214-3p/CENPM axis and the circulating D1-WNT pathway in head and neck squamous cell carcinoma [ 25 , 26 ] Similarly, LINC01703 enhances the invasiveness of NSCLC cells by altering Mir-605-3p/MACC1 [ 27 ], LncRNA SNHG16 drives the proliferation and invasion of papillary thyroid carcinoma by regulating Mir-497 [ 28 ], TSPEAR-AS2, Up-regulation of PPM1A by sponging Mir-487a-3p promotes the progression of oral squamous cell carcinoma [ 29 ]. Furthermore, the HSA-Mir-497-5p-NUTM2A-AS1 axis has been verified in recent studies [ 30 ].…”

Correlation of small nucleolar RNA host gene 16 with acute respiratory distress syndrome occurrence and prognosis in sepsis patients

“…Meanwhile, the qPCR was executed with KOD SYBR® qPCR Mix (Toyobo, Japan). The primers were designed according to a previous study 14 . Subsequently, the lnc‐SNHG16 expression was analyzed using the 2 ‐ΔΔCt method (GAPDH as an internal control).…”

“…The primers were designed according to a previous study. 14 Subsequently, the lnc-SNHG16 expression was analyzed using the 2 -ΔΔCt method (GAPDH as an internal control).…”