Local persistence of novel regional variants of La Crosse virus in the Northeast USA

Abstract

Background: La Crosse virus (LACV) (genus Orthobunyavirus, family Peribunyaviridae) is a mosquito-borne virus that causes pediatric encephalitis and accounts for 50–150 human cases annually in the USA. Human cases occur primarily in the Midwest and Appalachian regions whereas documented human cases occur very rarely in the northeastern USA. Methods: Following detection of a LACV isolate from a field-collected mosquito in Connecticut during 2005, we evaluated the prevalence of LACV infection in local mosquito populations and genetically characterized virus isolates to determine whether the virus is maintained focally in this region.Results: During 2018, we detected LACV in multiple species of mosquitoes, including those not previously associated with the virus. We also evaluated the phylogenetic relationship of LACV strains isolated from 2005–2018 in Connecticut and found that they formed a genetically homogeneous clade that was most similar to strains from New York State.Conclusion: Our analysis argues for local isolation and long-term persistence of a genetically distinct lineage of LACV within this region. We highlight the need to determine more about the phenotypic behavior of these isolates, and whether this virus lineage poses a threat to public health.

Aedes Albopictus and Cache Valley virus: a new threat for virus transmission in New York State

“…Real- time RT–PCR assay was performed by using CVV_F (ACAGCCAATGGTGTCGAAAAC), CVV_R (TGCAGGGATGCTAGACAAGATG) primers, and CVV_P (6FAM-CTGACGGTATTGAATCAGCAT-MGBNFQ) probe for CVV detection. Maximum likelihood estimation (MLE) calculations to determine prevalence of CVV in mosquitoes were based upon a program developed by Dr. Brad Biggerstaff as shown on the CDC website, https://www.cdc.gov/westnile/resourcepages/mosqsurvsoft.html [ 23 , 24 ]. Statistical analysis of the virus detection data by year, species, and regions (number of pools) were carried out at a significance level of p < 0.05 using OpenEpi, Version 3, open-source calculator–TwobyTwo ( https://www.openepi.com/TwobyTwo/TwobyTwo.htm ).…”