Local subplasma membrane Ca ²⁺ signals detected by a tethered Ca ²⁺ sensor

Abstract

Accumulating evidence indicates that plasma membrane (PM) microdomains and the subjacent ''junctional'' sarcoplasmic͞endo-plasmic reticulum (jS͞ER) constitute specialized Ca 2؉ signaling complexes in many cell types. We examined the possibility that some Ca 2؉ signals arising in the junctional space between the PM and jS͞ER may represent cross-talk between the PM and jS͞ER. The Ca 2؉ sensor protein, GCaMP2, was targeted to different PM domains by constructing genes for fusion proteins with either the ␣1 or ␣2 isoform of the Na ؉ pump catalytic (␣) subunit. These fusion proteins were expressed in primary cultured mouse brain astrocytes and arterial smooth muscle cells. Immunocytochemistry demonstrated that ␣2(f)GCaMP2, like native Na ؉ pumps with ␣2-subunits, sorted to PM domains that colocalized with subjacent S͞ER; ␣1(f)GCaMP2, like Na ؉ pumps with ␣1-subunits, was more uniformly distributed. The GCaMP2 moieties in both constructs were tethered just beneath the PM. Both constructs detected global Ca 2؉ signals evoked by serotonin (in arterial smooth muscle cells) and ATP, and by store-operated Ca 2؉ channel-mediated Ca 2؉ entry after S͞ER unloading with cyclopiazonic acid (in Ca 2؉ -free medium). When cytosolic Ca 2؉ diffusion was markedly restricted with EGTA, however, only ␣2(f)GCaMP2 detected the local, storeoperated Ca 2؉ channel-mediated Ca 2؉ entry signal. Thus, ␣1 Na ؉ pumps are apparently excluded from the PM microdomains occupied by ␣2 Na 2؉ pumps. The jS͞ER and adjacent PM may communicate by Ca 2؉ signals that are confined to the tiny junctional space between the two membranes. Similar methods may be useful for studying localized Ca 2؉ signals in other subPM microdomains and signals associated with other organelles.arterial smooth muscle ͉ astrocytes ͉ Na ϩ pump ͉ PLasmERosome ͉ store-operated Ca 2ϩ entry

Genetically Encoded Fluorescent Indicators for Organellar Calcium Imaging

“…This suggests that Ca 2þ signals in the subplasmamembranous regions can be separately regulated from those in the cytosol. Therefore, the subplasmamembranous domains have been one of the major targets of GECIs, and several types of GECIs have been localized to the plasma membrane by fusion with plasma membrane-anchoring motifs, such as myristoylation, palmitoylation, or farnesylation tags (18,61), or with plasma membrane-localized transporters (62,63). GEGIs fused with synaptic proteins, such as synaptosome-associated protein of 25 kDa (SNAP25), synaptophysin, and synaptobrevin, have been also used to detect microdomain Ca 2þ signals in the synapse (18,64).…”

Development and characterization of a novel fluorescent indicator protein PMCA4-GCaMP2 in cardiomyocytes

“…In another study, Lee et al linked GCaMP2 with the α1 and α2 subunits of the Na + /K + ATPase pump and overexpressed these in astrocytes. These sensors were able to define a different subsarcolemmal calcium environment related to each subunit [12]. More recently, GCaMP2 was cloned to subcellular targeting proteins to target the GCaMP2 to certain sub-cellular localisations; an approach which proved successful in detecting subcellular local calcium.…”

“…In this study we fused PMCA4 with a genetically encoded calcium indicator (GECI) [12,13] and characterized its properties in situ in cardiomyocytes. We used the GFP-based GECI (GCaMP2), which exploits the calcium/calmodulin dependent rearrangement of recombinant GFP that results in an increase in fluorescence intensity upon binding with calcium/calmodulin [14].…”

Derived (Mutated)–Types of TRPV6 Channels Elicit Greater Ca2+ Influx Into the Cells Than Ancestral-Types of TRPV6: Evidence From Xenopus Oocytes and Mammalian Cell Expression System

“…The PCR primers, designed to anneal themselves, were as follows: 5′-GGAGATCTG GATCCGATATCCGCCACCATGCTGTGCTGTAT GAGAAGAACCAAACAGG-3′ and 5′-GGGTCGAC AATCTTTTGGTCCTCATCATTCTTTTCAACCTG TTTGGTTCTTCTCATACAGC-3′. The 0.09-kb PCR product was digested with BglII and SalI and ligated with the 1.25-kb SalI-NotI fragment from pN1-G-CaMP2 (13) and with the 3.94-kb BglII-NotI vector fragment from pN1-G-CaMP (14). The construct was verified by sequencing.…”