Long-term hepatitis B infection in a scalable hepatic co-culture system

Winer, Benjamin Y.; Huang, Tiffany; Pludwinski, Eitan; Heller, Brigitte; Wojcik, Felix; Lipkowitz, Gabriel; Parekh, Amit; Cho, Cheul; Shrirao, Anil B.; Muir, Tom W.; Novik, Eric; Ploß, Alexander

doi:10.1038/s41467-017-00200-8

Cited by 61 publications

(65 citation statements)

References 53 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Recently, we showed that SACC‐PHHs can be robustly and persistently infected with HBV for up to 40 days with little donor‐to‐donor variability and without suppressing innate immune signaling . Building on this work, we demonstrate here that PHHs in SACCs support long‐term HBV‐HDV co‐infection in microwell plate formats.…”

supporting

confidence: 54%

“…Recently, we showed that SACC-PHHs can be robustly and persistently infected with HBV for up to 40 days with little donor-to-donor variability and without suppressing innate immune signaling. (19) Building on this work, we demonstrate here that PHHs in SACCs support long-term HBV-HDV co-infection in microwell plate formats. Establishing long-term HBV/HDV infection in a microscale, 384-well format is a significant improvement even over 96-well formats, as it would enable high-throughput screens in automated settings.…”

supporting

confidence: 51%

See 1 more Smart Citation

Analysis of Host Responses to Hepatitis B and Delta Viral Infections in a Micro‐scalable Hepatic Co‐culture System

et al. 2019

Self Cite

View full text Add to dashboard Cite

Hepatitis B virus (HBV) remains a major global health problem with 257 million chronically infected individuals worldwide, of whom approximately 20 million are co‐infected with hepatitis delta virus (HDV). Progress toward a better understanding of the complex interplay between these two viruses and the development of novel therapies have been hampered by the scarcity of suitable cell culture models that mimic the natural environment of the liver. Here, we established HBV and HBV/HDV co‐infections and super‐infections in self‐assembling co‐cultured primary human hepatocytes (SACC‐PHHs) for up to 28 days in a 384‐well format and highlight the suitability of this platform for high‐throughput drug testing. We performed RNA sequencing at days 8 and 28 on SACC‐PHHs, either HBV mono‐infected or HBV/HDV co‐infected. Our transcriptomic analysis demonstrates that hepatocytes in SACC‐PHHs maintain a mature hepatic phenotype over time, regardless of infection condition. We confirm that HBV is a stealth virus, as it does not induce a strong innate immune response; rather, oxidative phosphorylation and extracellular matrix–receptor interactions are dysregulated to create an environment that promotes persistence. Notably, HDV co‐infection also did not lead to statistically significant transcriptional changes across multiple donors and replicates. The lack of innate immune activation is not due to SACC‐PHHs being impaired in their ability to induce interferon stimulated genes (ISGs). Rather, polyinosinic:polycytidylic acid exposure activates ISGs, and this stimulation significantly inhibits HBV infection, yet only minimally affects the ability of HDV to infect and persist. Conclusion: These data demonstrate that the SACC‐PHH system is a versatile platform for studying HBV/HDV co‐infections and holds promise for performing chemical library screens and improving our understanding of the host response to such infections.

show abstract

supporting

confidence: 54%

supporting

confidence: 51%

Analysis of Host Responses to Hepatitis B and Delta Viral Infections in a Micro‐scalable Hepatic Co‐culture System

et al. 2019

Self Cite

View full text Add to dashboard Cite

show abstract

“…Pregenomic ribonucleic acid (pgRNA) in the liver of chimeric mice was quantified with the Luna Universal One‐Step RT‐qPCR Kit (New England BioLabs). The primers for WMHBV were forward primer ACCCAATGCCCCTATCTTATC and reverse primer CAGGAAGATGCTGGAGATTG, and the primers for HBV were forward primer GAGTGTGGATTCGCACTCC and reverse primer GAGGCGAGGGAGTTCTTCT …”

Section: Methodsmentioning

confidence: 99%

“…The primers for WMHBV were forward primer ACCCAATGCCCCTATCTTATC and reverse primer CAGGAAGATGCTGGAGATTG, and the primers for HBV were forward primer GAGTGT GGATTCGCACTCC and reverse primer GAGG CGAGGGAGTTCTTCT. (21)…”

Section: Quantification Of Viral Pregenomic Ribonucleic Acid From LIVmentioning

confidence: 99%

Woolly Monkey–HBV Infection in Squirrel Monkeys as a Surrogate Nonhuman Primate Model of HBV Infection

et al. 2020

Self Cite

View full text Add to dashboard Cite

Development of curative therapies for chronic hepatitis B virus (HBV) infection will likely require new animal models. Here, we evaluate HBV infection in squirrel monkeys based on the high‐sequence homology of the HBV receptor, Na+/taurocholate co‐transporting peptide (NTCP), between humans and squirrel monkeys. HBV PreS1 peptide was examined for binding human and squirrel monkey NTCP. Immunodeficient Fah−/−, NOD, Rag1−/−, Il2Rgnull (FNRG) mice engrafted with human or squirrel monkey hepatocytes were challenged with HBV or Woolly Monkey HBV (WMHBV). In addition, adult squirrel monkeys were inoculated with HBV, WMHBV, adeno‐associated virus containing an infectious genome of HBV (AAV‐HBV), and AAV‐WMHBV. Finally, neonate squirrel monkeys were assessed for the potential of chronic infection with WMHBV. PreS1 peptide efficiently bound to human and squirrel monkey NTCP but not to mouse or capuchin NTCP. FNRG mice engrafted with squirrel monkey hepatocytes were susceptible to infection by WMHBV but not human HBV. Similarly, adult squirrel monkeys could be infected with WMHBV but not human HBV, whereas chimeric mice engrafted with human hepatocytes were susceptible to HBV but not WMHBV. Infection of squirrel monkeys with AAV‐WMHBV yielded maximum viremia of 108 genomes/mL with detectable virus for up to 8 months. Notably, covalently closed circular DNA was detected in the liver of these animals. Infection of neonates with WMHBV led to detectable viremia for up to 6 months. Conclusions: Adult and neonate squirrel monkeys exhibited prolonged WMHBV viremia lasting 6‐8 months. This is greater than twice the duration of viremia achieved in other nonhuman primates and suggests that squirrel monkeys may be a suitable model for testing HBV therapeutics.

show abstract

“…An important extension to using long-term hepatocytes for metabolism studies is their application to pharmacology (Winer et al, 2017, Shlomai et al, 2014 and toxicology investigations (March et al, 2015, Trask et al, 2014 for the effective integration of the data for PBPK modeling. Study 3 showed that the HepatoPac® system could be successfully infected cultures, e.g.…”

Section: Future Applications -Diseased Statementioning

confidence: 99%

Simultaneous Assessment of Clearance, Metabolism, Induction, and Drug-Drug Interaction Potential Using a Long-Term In Vitro Liver Model for a Novel Hepatitis B Virus Inhibitor

Kratochwil

Triyatni

Mueller

et al. 2018

J Pharmacol Exp Ther

View full text Add to dashboard Cite

Long-term hepatitis B infection in a scalable hepatic co-culture system

Cited by 61 publications

References 53 publications

Analysis of Host Responses to Hepatitis B and Delta Viral Infections in a Micro‐scalable Hepatic Co‐culture System

Analysis of Host Responses to Hepatitis B and Delta Viral Infections in a Micro‐scalable Hepatic Co‐culture System

Woolly Monkey–HBV Infection in Squirrel Monkeys as a Surrogate Nonhuman Primate Model of HBV Infection

Simultaneous Assessment of Clearance, Metabolism, Induction, and Drug-Drug Interaction Potential Using a Long-Term In Vitro Liver Model for a Novel Hepatitis B Virus Inhibitor

Contact Info

Product

Resources

About