Loop-mediated isothermal amplification for <i>Candida s</i>pecies surveillance in under-resourced setting: a review of evidence

Owoicho, Oloche; Olwal, Charles Ochieng’; Tettevi, Edward J.; Atu, Bernard Ortwer; Durugbo, Ernest Uzodimma

doi:10.1080/14737159.2022.2109963

Cited by 8 publications

(3 citation statements)

References 75 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…eLAMP is a software program that can perform a virtual simulation of LAMP reactions by matching the primer set of conjectures on the printed sequence [ 44 ]. The program uses base matching techniques, primer 3’ mismatches, and distance measurements between regions to perform specificity analyses [ 43 ].…”

Section: Discussionmentioning

confidence: 99%

Reverse transcription loop-mediated isothermal amplification (RT-LAMP) primer design based on Indonesia SARS-CoV-2 RNA sequence

Ibadurrahman,

Suryani,

Desriani

2023

Journal of Genetic Engineering and Biotechnology

View full text Add to dashboard Cite

Background The COVID-19 pandemic has highlighted the importance of tracking cases by using various methods such as the Reverse transcription loop-mediated isothermal amplification (RT-LAMP) which is a fast, simple, inexpensive, and accurate mass tracker. However, there have been no reports about the development of RT-LAMP primer designs that use genome sequences of viruses from Indonesia. Therefore, this study aimed to design an RT-LAMP primer using SARS-CoV-2 genome sequences from Indonesia and several other countries representing five continents in the world, as well as genomes from five Variants of Concern (VOC). Result The results showed that the consensus sequence of 70 SARS-CoV-2 virus sequences was obtained with a length of 29,982 bases. The phylogenetic test confirmed that the consensus sequence had a close kinship with the SARS-CoV-2 Wuhan Isolate. Furthermore, the SimPlot analysis showed that there was a high genetic diversity of sequences from the Coronaviridae tribal virus at base sequences of 1,500–5,000, 6,500–7,500, and 23,300–25,500. A total of 139 sets of primers were obtained from the primer design with 4 sets namely T1_6, T1_9, T4_7, and T4_52 having the best characteristics. Based on the secondary structure analysis test on 4 sets of primers, T1_6 and T1_9 were predicted not to form secondary structures at RT-LAMP operational temperatures. The primer set T1_9 showed better specificity in BLAST NCBI and eLAMP BLAST tests. Conclusion This study obtained a primer set of T1_9 with base sequence F3: CACTGAGACTCATTGATGCTATG, B3: CCAACCGTCTCTAAGAAACTCT, F2: GTTCACATCTGATTTGGCTACT, F1c: GAAGTCAACTGAACAACACCACCT, B2: CCTTCCTTAAACTTCTCTTCAAGC, B1c: GTGGCTAACTAACATCTTTGGCACT, LB: TGAAAACAAACCCGCCGTCCTTG, which meets the ideal parameters and has the best specificity. Therefore, it is recommended for use in further tests to recognize SARS-CoV-2 from Indonesia, other five continents, as well as five VOCs, including the new Omicron sub-variant.

show abstract

Section: Discussionmentioning

confidence: 99%

Reverse transcription loop-mediated isothermal amplification (RT-LAMP) primer design based on Indonesia SARS-CoV-2 RNA sequence

Ibadurrahman,

Suryani,

Desriani

2023

Journal of Genetic Engineering and Biotechnology

View full text Add to dashboard Cite

show abstract

“…In the future, to fully test the performance of the RPT system, more clinical samples need to be collected and tested. Further, it would be better if the culture results, detection results using commercial clinical kits, and sequencing results could be collected at the same time [28]. With the participation of a microfluidic chip, the multiplex identification of the Candida species was realized in a reaction.…”

Section: Validation Of the Rpt System Assay With Clinical Samplesmentioning

confidence: 99%

“…It has been utilized for the detection of pathogens, such as SARS-CoV-2, and methicillin-resistant Staphylococcus aureus (MRSA), in POCT or resource-limited regions because it does not require sophisticated instruments [26,27]. There has been some work using LAMP to identify Candida species in an isothermal and multi-target way [28][29][30][31][32]. Some works also realized the detection with the participation of microfluidic chips [33,34].…”

Section: Introductionmentioning

confidence: 99%

An Integrated and Multi-Target Nucleic Acid Isothermal Analysis System for Rapid Diagnosis of Vulvovaginal Candidiasis

Jin

Mao

et al. 2023

Biosensors

View full text Add to dashboard Cite

Rapid identification of Candida species is significant for the diagnosis of vulvovaginal candidiasis (VVC). An integrated and multi-target system for the rapid, high-specificity, and high-sensitivity detection of four Candida species was developed. The system consists of a rapid sample processing cassette and a rapid nucleic acid analysis device. The cassette could process the Candida species to release nucleic acids in 15 min. The released nucleic acids were analyzed by the device as fast as within 30 min, using the loop-mediated isothermal amplification method. The four Candida species could be simultaneously identified, with each reaction using only 1.41 µL of reaction mixture, which was low cost. The RPT (rapid sample processing and testing) system could detect the four Candida species with high sensitivity (<2 CFU/reaction) and high specificity. The system also processed and analyzed 32 clinical samples, giving the results with high clinical sensitivity and specificity. Hence, the system was a significant and effective platform for the diagnosis of VVC. Furthermore, the period of validity of the reagents and chips used in the system was >90 days, and the system could also be used for the detection of bacteria.

show abstract

Assessment of LAMPAuris for Rapid Detection of Candida auris in Clinical Specimens

Yamamoto,

Alshahni,

Komori

et al. 2024

Mycopathologia

View full text Add to dashboard Cite

Loop-mediated isothermal amplification for Candida species surveillance in under-resourced setting: a review of evidence

Cited by 8 publications

References 75 publications

Reverse transcription loop-mediated isothermal amplification (RT-LAMP) primer design based on Indonesia SARS-CoV-2 RNA sequence

Reverse transcription loop-mediated isothermal amplification (RT-LAMP) primer design based on Indonesia SARS-CoV-2 RNA sequence

An Integrated and Multi-Target Nucleic Acid Isothermal Analysis System for Rapid Diagnosis of Vulvovaginal Candidiasis

Assessment of LAMPAuris for Rapid Detection of Candida auris in Clinical Specimens

Contact Info

Product

Resources

About