Loss of Atg2b and Gskip Impairs the Maintenance of the Hematopoietic Stem Cell Pool Size

Abstract

A germline copy number duplication of chromosome 14q32, which contains ATG2B and GSKIP , was identified in families with myeloproliferative neoplasm (MPN). Herein, we show that mice lacking both Atg2b and Gskip , but not either alone, exhibited decreased hematopoiesis, resulting in death in utero accompanied by anemia. In marked contrast to MPN patients with duplication of ATG2B and GSKIP , the number of hematopoietic stem cells (HSCs), in particular long-term HSCs, in double knockout fetal livers were significantly decreased due to increased cell death. Although the remaining HSCs still had the ability to differentiate into hematopoietic progenitor cells, the differentiation efficiency was quite low. Remarkably, mice with knockout of Atg2b or Gskip alone did not show any hematopoietic abnormality. Mechanistically, while loss of both genes had no effect on autophagy, it increased the expression of genes encoding enzymes involved in oxidative phosphorylation. Taken together, our results indicate that Atg2b and Gskip play a synergistic effect in maintaining the pool size of HSCs.

The UFM1 system regulates ER-phagy through the ufmylation of CYB5R3

“…A single-stranded oligodeoxynucleotide (ssODN) (5′-CCAAGGGCAGTCCCTGAGTCACCT GTCTTGACTGGGTGGCCTGTCTCCTGCAGTCCGAGAGAGACATCCTG TTGCGGCCTGAGCTGGAGGAACTGAGGAACGAACATTCTGCTCGCTT CAAGCTC-3′) harboring a K214R mutation flanked by 60-bp homologous arms corresponding to exon8 of Cyb5r3 was custom synthesized by Eurofins Genomics Japan (Tokyo, Japan) for CRISPR/Cas-mediated knock-in. The CRISPR/Cas9 solution was prepared as previously described 50 , with minor modifications. Briefly, lyophilized crRNAs and tracrRNA were resuspended in Nuclease-Free Duplex Buffer (IDT) to a concentration of 240 μM.…”

Clonal analysis of fetal hematopoietic stem/progenitor cell subsets reveals how post-transplantation capabilities are distributed

“…Although is it known that long-term hematopoietic reconstitution is possible from CD150-cells in the E14.5 FL (Kent et al, 2009; Kim et al, 2006; Papathanasiou et al, 2009), how much of the LT-RU biomass they represent is not known. This is an important issue that requires resolution because of how ubiquitously CD150 expression is used as a hurdle criterion for the quantitative and qualitative analysis of the fetal LT-RU pool (for examples see (Che et al, 2022; Ganuza et al, 2022; Gao et al, 2022; Hall et al, 2022; Lee et al, 2022; Patel et al, 2022; Sakai et al, 2022; Van Deren et al, 2022; Young et al, 2021)).…”

The dual role of autophagy in acute myeloid leukemia

“…The germline duplication of ATG2B and GSKIP is related to a familial predisposition to myeloid malignancies and partly associated with TET2 , but not DNMT3A , mutation [ 131 , 132 ]. Although Atg2b and Gskip are required to maintain hematopoietic stem cell numbers and hematopoiesis [ 133 ], the autophagy regulation of these genes in AML tumorigenesis is unclear. A further complication in the genetic mutations of AML in studying the relevance of autophagy contribution is because the fusion oncogene AML1-ETO may collaborate with the mutations of ASXL1/2 for AML tumorigenesis [ 134 ].…”