Loss of Wild-Type MEN1 Gene Expression in Multiple Endocrine Neoplasia Type 1-Associated Parathyroid Adenoma.

Abstract

Abstract.Multiple endocrine neoplasia type 1(MEN1) is a human hereditary tumor syndrome characterized by the development of endocrine adenomas of the parathyroid, anterior pituitary, and enteropancreatic tissue. Several lines of evidence have implicated the recently identified MENI gene located on chromosome 11813 as a recessive tumor suppressor gene. Here, we analyzed MENI wild-type gene expression in tumors from a large MEN1 kindred. A deletion of codons 227-228 (678de16) located in exon 4 was found in tumor and peripheral blood complementary DNA using a simplified single-strand conformational polymorphism (SSCP) approach well suited for clinical MENI mutation screening. The identified 678de16 cDNA mutation deletes a potential phosphorylation site (Tyr227) and corresponds to a germ line mutation co-segregating with disease phenotype in this MENI family. Loss of heterozygosity analysis by fluorescent microsatellite PCR showed an exclusive loss of the MEN1 wild-type (and retention of the mutated) allele detectable in DNA from microdissected parathyroid and pancreatic, but not in adrenal, adenomas.Our findings confirm the synergism between MENI gene mutations and subsequent MENI allelic losses in the tumorigenesis of MEN1-associated adenomas.

Multiple endocrine neoplasia type 1 (MEN1) gene mutations in a subset of patients with sporadic and familial primary hyperparathyroidism target the coding sequence but spare the promoter region

“…LOH of the MEN1 locus was found in all parathyroid tumours from these MEN1 mutation-positive patients (fluorescence curves not shown). Together with the somatic mutations described above, these findings indicate that similar to parathyroid adenomas associated with the familial MEN1 syndrome (Ludwig et al 1999), bi-allelic loss of wild-type MEN1 expression may be found in sporadic HP, though at lower prevalence. In our studies, LOH analysis was not performed in HP patients without somatic MEN1 mutations, as peripheral blood DNA was not obtained from these individuals.…”

“…These findings suggest that, as in MEN1-associated HP adenoma (Ludwig et al 1999), a bi-allelic loss of MEN1 wild-type gene expression caused by germ line MEN1 mutation and a subsequent LOH is critically involved in tumour development in fiHP in this family. No clinical or laboratory findings suggesting additional endocrine dysfunction was present in individuals with HP (currently aged 58, 60 and 33 years), thus making MEN1 syndrome very unlikely.…”

“…The diagnosis of sporadic primary HP was based on elevated serum calcium (d2·75 mmol/l) and parathyroid hormone (PTH; d6·8 pmol/l) levels, and a negative family history. One patient with HP associated with familial MEN1 carrying germ line MEN1 mutation 678 del6 has been described earlier (patient 1 in Ludwig et al 1999). Patients with secondary HP due to chronic renal failure had elevated serum creatinine levels (587·7 297·7 mmol/l, mean ..)…”

“…Oligonucleotide primer sequences and reaction conditions have been described . The following sense/antisense primer combinations were used as described (Ludwig et al 1999), with numbers indicating the 5 nucleotide of primers in reference to MEN1 genomic sequence (Genbank U93237): 2241/ 2561, 2508/4431, 4370/ 5346, 5210/7199, 6693/7734, and 7685/8084. To study the intronic mutation 654+3(A<G) leading to a partial deletion of exon 3 through alternative splicing, primers 4370 and 5 TCCTGCCCCATTGGCTCAGC (intron 4) were used for genomic PCR and sequencing.…”

“…The gene product of MEN1, menin, is a 610 amino acid nuclear protein interacting with the AP1 transcription factor JunD (Agarwal et al 1999). In affected tissues, MEN1 wild-type gene expression is typically abrogated through allelic loss of heterozygosity (LOH) for chromosome 11q13 harbouring the MEN1 gene locus (Ludwig et al 1999).…”