&lt;p&gt;DEP Domain-Containing Protein 1B (DEPDC1B) Promotes Migration and Invasion in Pancreatic Cancer Through the Rac1/PAK1-LIMK1-Cofilin1 Signaling Pathway&lt;/p&gt;

Zhang, Shan; Shi, Weiwei; Hu, Wei; Ma, Ding; Yan, Dongming; Yu, Kuanyong; Zhang, Guang; Cao, Yin; Wu, Junhua; Jiang, Chunping; Wang, Zhong‐Xia

doi:10.2147/ott.s229055

Cited by 25 publications

(18 citation statements)

References 34 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…More recently, it was demonstrated that the KD of DEPDC1B inhibits the occurrence of malignant melanoma by inhibiting cell proliferation and inducing cell apoptosis 26 . Moreover, DEPDC1B was found to be able to promote migration and invasion of pancreatic cancer through Rac1/PAK1-LIMK1-Cofilin1 signal pathway 28 . However, the understanding of the relationship between DEPDC1B and human cancers and the underlying mechanism was still in shortage.…”

Section: Discussionmentioning

confidence: 97%

DEPDC1B is a tumor promotor in development of bladder cancer through targeting SHC1

Lai

Zhou

et al. 2020

Cell Death Dis

View full text Add to dashboard Cite

Bladder cancer is one of the most commonly diagnosed malignant tumors in the urinary system and causes a massive cancer-related death. DEPDC1B is a DEP domain-containing protein that has been found to be associated with a variety of human cancers. This study aimed to explore the role and mechanism of DEPDC1B in the development of bladder cancer. The analysis of clinical specimens revealed the upregulated expression of DEPDC1B in bladder cancer, which was positively related to tumor grade. In vitro and in vivo studies showed that DEPDC1B knockdown could inhibit the growth of bladder cancer cells or xenografts in mice. The suppression of bladder cancer by DEPDC1B was executed through inhibiting cell proliferation, cell migration, and promoting cell apoptosis. Moreover, a mechanistic study found that SHC1 may be an important route through which DEPDC1B regulates the development of bladder cancer. Knockdown of SHC1 in DEPDC1B-overexpressed cancer cells could abolish the promotion effects induced by DEPDC1B. In conclusion, DEPDC1B was identified as a key regulator in the development of bladder cancer, which may be used as a potential therapeutic target in the treatment of bladder cancer.

show abstract

Section: Discussionmentioning

confidence: 97%

DEPDC1B is a tumor promotor in development of bladder cancer through targeting SHC1

Lai

Zhou

et al. 2020

Cell Death Dis

View full text Add to dashboard Cite

show abstract

“…In addition, DEPDC1B is required for a variety of malignancies, such as breast cancer [ 11 , 16 ], non-small cell lung cancer [ 17 ], oral cancer [ 18 ], prostate cancer [ 19 ], melanoma [ 20 ], and glioblastoma [ 21 ]. In pancreatic cancer or prostate cancer, DEPDC1B could promote migration and invasion through Rac1/PAK1 signaling [ 22 , 23 ]. In bladder cancer, DEPDC1B is a tumor promotor through targeting SHC1 [ 24 ].…”

Section: Introductionmentioning

confidence: 99%

DEPDC1B regulates the progression of human chordoma through UBE2T-mediated ubiquitination of BIRC5

Wang

Tang

et al. 2021

Cell Death Dis

View full text Add to dashboard Cite

Chordoma is a rare bone malignancy with a high rate of local recurrence and distant metastasis. Although DEP domain-containing protein 1B (DEPDC1B) is implicated in a variety of malignancies, its relationship with chordoma is unclear. In this study, the biological role and molecular mechanism of DEPDC1B in chordoma were explored. The function of DEPDC1B in chordoma cells was clarified through loss-of-function assays in vitro and in vivo. Furthermore, molecular mechanism of DEPDC1B in chordoma cells was recognized by RNA sequencing and Co-Immunoprecipitation (Co-IP) assay. The malignant behaviors of DEPDC1B knockdown chordoma cells was significantly inhibited, which was characterized by reduced proliferation, enhanced apoptosis, and hindered migration. Consistently, decreased expression of DEPDC1B suppressed tumor growth in xenograft mice. Mechanically, DEPDC1B affected the ubiquitination of baculoviral inhibitor of apoptosis repeat-containing 5 (BIRC5) through ubiquitin-conjugating enzyme E2T (UBE2T). Simultaneous downregulation of BIRC5 and DEPDC1B may exacerbate the inhibitory effects of chordoma. Moreover, BIRC5 overexpression reduced the inhibitory effects of DEPDC1B knockdown in chordoma cells. In conclusion, DEPDC1B regulates the progression of human chordoma through UBE2T-mediated ubiquitination of BIRC5, suggesting that it may be a promising candidate target with potential therapeutic value.

show abstract

“…A reverse transcription system was used to obtain the first-strand template Complementary DNA (cDNA). The primer sequences were used as follows: DEPDC1B: 5′- GAGCTACCAGGCTGTGGAAT-3′ (forward) and 5′- GCCGAAGTTTTGACTGCACC -3′ (reverse); GAPDH: 5′-CCATGTTCGTCATGGGTGTGAACCA-3′(forward) and 5′-GCCAGTAGAGGCAGGGATGATGTTC-3′(reverse) ( Li et al, 2020 ; Zhang et al, 2020 ). The expression of GAPDH was considered as an internal control.…”

Section: Methodsmentioning

confidence: 99%

Identification and Validation of DEPDC1B as an Independent Early Diagnostic and Prognostic Biomarker in Liver Hepatocellular Carcinoma

et al. 2022

View full text Add to dashboard Cite

Liver hepatocellular carcinoma (LIHC) is one of the most lethal tumors worldwide, and while its detailed mechanism of occurrence remains unclear, an early diagnosis of LIHC could significantly improve the 5-years survival of LIHC patients. It is therefore imperative to explore novel molecular markers for the early diagnosis and to develop efficient therapies for LIHC patients. Currently, DEPDC1B has been reported to participate in the regulation of cell mitosis, transcription, and tumorigenesis. To explore the valuable diagnostic and prognostic markers for LIHC and further elucidate the mechanisms underlying DEPDC1B-related LIHC, numerous databases, such as Oncomine, Gene Expression Profiling Interactive Analysis (GEPIA), UALCAN, Kaplan-Meier plotter, and The Cancer Genome Atlas (TCGA) were employed to determine the association between the expression of DEPDC1B and prognosis in LIHC patients. Generally, the DEPDC1B mRNA level was highly expressed in LIHC tissues, compared with that in normal tissues (p < 0.01). High DEPDC1B expression was associated with poor overall survival (OS) in LIHC patients, especially in stage II, IV, and grade I, II, III patients (all p < 0.05). The univariate and multivariate Cox regression analysis showed that DEPDC1B was an independent risk factor for OS among LIHC patients (HR = 1.3, 95% CI: 1.08–1.6, p = 0.007). In addition, the protein expression of DEPDC1B was validated using Human Protein Atlas database. Furthermore, the expression of DEPDC1B was confirmed by quantitative real-time polymerase chain reaction (qRT-PCR) assay using five pairs of matched LIHC tissues and their adjacent noncancerous tissues. The KEGG pathway analysis indicated that high expression of DEPDC1B may be associated with several signaling pathways, such as MAPK signaling, the regulation of actin cytoskeleton, p53 signaling, and the Wnt signaling pathways. Furthermore, high DEPDC1B expression may be significantly associated with various cancers. Conclusively, DEPDC1B may be an independent risk factor for OS among LIHC cancer patients and may be used as an early diagnostic marker in patients with LIHC.

show abstract

<p>DEP Domain-Containing Protein 1B (DEPDC1B) Promotes Migration and Invasion in Pancreatic Cancer Through the Rac1/PAK1-LIMK1-Cofilin1 Signaling Pathway</p>

Cited by 25 publications

References 34 publications

DEPDC1B is a tumor promotor in development of bladder cancer through targeting SHC1

DEPDC1B is a tumor promotor in development of bladder cancer through targeting SHC1

DEPDC1B regulates the progression of human chordoma through UBE2T-mediated ubiquitination of BIRC5

Identification and Validation of DEPDC1B as an Independent Early Diagnostic and Prognostic Biomarker in Liver Hepatocellular Carcinoma

Contact Info

Product

Resources

About